KIR2DL1 (NM_014218) Human Untagged Clone

CAT#: SC304064

KIR2DL1 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 (KIR2DL1)



  "NM_014218" in other vectors (6)

CNY 3,656.00

CNY 5,610.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
KIR2DL1 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD158A; KIR-K64; KIR2DL3; KIR221; NKAT; NKAT-1; NKAT1; p58.1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_014218 edited
ATGTCGCTCTTGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGG
CCACATGAGGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCGCCTGGTGAAA
TCAGAAGAGACAGTCATCCTGCAGTGTTGGTCAGATGTCATGTTTGAACACTTCCTTCTG
CACAGAGAGGGGATGTTTAACGACACTTTGCGCCTCATTGGAGAACACCATGATGGGGTC
TCCAAGGCCAACTTCTCCATCAGTCGCATGACGCAAGACCTGGCAGGGACCTACAGATGC
TACGGTTCTGTTACTCACTCCCCCTATCAGGTGTCAGCTCCCAGTGACCCTCTGGACATC
GTGATCATAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCTGGGCCCCACGGTTCTG
GCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTA
TCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGGGCCCAAGGTCAACGGAACA
TTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGC
TCTTTCCATGACTCTCCATACGAGTGGTCAAAGTCAAGTGACCCACTGCTTGTTTCTGTC
ACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAAC
CCCCGACACCTGCACATTCTGATTGGGACCTCAGTGGTCATCATCCTCTTCATCCTCCTC
TTCTTTCTCCTTCATCGCTGGTGCTCCAACAAAAAAAATGCTGCGGTAATGGACCAAGAG
TCTGCAGGAAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTG
ACATACACACAGTTGAATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAG
AGGCCCAAGACACCCCCAACAGATATCATCGTGTACACGGAACTTCCAAATGCTGAGTCC
AGATCCAAAGTTGTCTCCTGCCCATGA
Restriction Sites Please inquire     
ACCN NM_014218
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014218.1, NP_055033.1
RefSeq Size 1593 bp
RefSeq ORF 1047 bp
Locus ID 3802
UniProt ID P43626
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity
Gene Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...