RIPPLY3 (NM_018962) Human Untagged Clone
CAT#: SC304640
DSCR6 (untagged)-Human Down syndrome critical region gene 6 (DSCR6)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DSCR6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_018962 edited
AGGCCCACCATGGAGCCCGAAGCGGCGGCCGGAGCCCGGAAGGCGCGGGGGCGCGGCTGT CACTGCCCCGGGGACGCTCCCTGGAGGCCTCCGCCACCGCGCGGGCCGGAGAGCCCCGCG CCGTGGCGACCTTGGATCCAGACACCTGGAGATGCTGAGCTGACCAGAACTGGAAGGCCG CTTGAACCTAGGGCTGACCAACACACTTTTGGATCAAAGGGAGCCTTTGGGTTTCAGCAT CCTGTAAGAGTCTATTTACCCATGTCAAAGCGTCAAGAATACCTGCGGAGTTCCGGGGAG CAAGTACTGGCCAGTTTCCCAGTGCAAGCCACGATTGACTTCTACGACGATGAGTCTACT GAGTCTGCTTCCGAAGCTGAAGAGCCAGAGGAAGGACCCCCACCCCTCCATCTTCTGCCC CAGGAGGTGGGAGGTCGGCAGGAAAATGGCCCAGGGGGAAAGGGCAGAGACCAGGGCATC AACCAAGGGCAGCGATCCTCAGGAGGGGGTGACCACTGGGGGGAGGGTCCGCTCCCTCAA GGTGTCTCCTCAAGGGGTGGCAAGTGCTCCTCATCCAAATAA |
Restriction Sites | Please inquire |
ACCN | NM_018962 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_018962.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_018962.1, NP_061835.1 |
RefSeq Size | 2262 bp |
RefSeq ORF | 573 bp |
Locus ID | 53820 |
UniProt ID | P57055 |
Gene Summary | Acts as a transcriptional corepressor. Negative regulator of the transcriptional activity of TBX1. Plays a role in the development of the pharyngeal apparatus and derivatives (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213078 | DSCR6 (Myc-DDK-tagged)-Human Down syndrome critical region gene 6 (DSCR6) |
CNY 2,400.00 |
|
RC213078L3 | Lenti ORF clone of Human Down syndrome critical region gene 6 (DSCR6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213078L4 | Lenti ORF clone of Human Down syndrome critical region gene 6 (DSCR6), mGFP tagged |
CNY 5,890.00 |
|
RG213078 | DSCR6 (tGFP-tagged) - Human Down syndrome critical region gene 6 (DSCR6) |
CNY 4,370.00 |
其它RIPPLY3产品