HES2 (NM_019089) Human Untagged Clone
CAT#: SC304669
HES2 (untagged)-Human hairy and enhancer of split 2 (Drosophila) (HES2)
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb40 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_019089 edited
ATGGGGCTGCCTCGCCGGGCAGGGGACGCGGCGGAGCTGCGCAAGAGCCTGAAGCCGCTG CTGGAGAAGCGCCGGCGCGCGCGCATCAACCAGAGCCTGAGCCAGCTTAAGGGGCTCATC CTGCCGCTGCTGGGCCGGGAGAACTCCAACTGCTCGAAGCTAGAGAAGGCAGACGTCCTG GAAATGACCGTGCGCTTCCTGCAGGAGCTGCCTGCGTCCTCATGGCCCACGGCAGCGCCC CTGCCTTGCGACAGCTACCGCGAGGGCTACAGCGCCTGTGTGGCGCGCCTGGCCCGCGTG CTGCCCGCCTGCCGTGTCCTGGAGCCCGCCGTGAGCGCGCGCCTGCTGGAGCACCTGTGG CGGAGAGCGGCCAGCGCCACCCTGGACGGCGGGCGCGCTGGGGATTCCAGTGGCCCGTCT GCCCCCGCCCCAGCGCCCGCGTCTGCCCCAGAGCCCGCATCCGCTCCGGTGCCCTCGCCG CCCTCGCCTCCCTGCGGCCCTGGCCTCTGGCGGCCGTGGTAG |
Restriction Sites | Please inquire |
ACCN | NM_019089 |
Insert Size | 530 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019089.3, NP_061962.2 |
RefSeq Size | 4259 bp |
RefSeq ORF | 522 bp |
Locus ID | 54626 |
UniProt ID | Q9Y543 |
Gene Summary | Transcriptional repressor of genes that require a bHLH protein for their transcription.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221455 | HES2 (Myc-DDK-tagged)-Human hairy and enhancer of split 2 (Drosophila) (HES2) |
CNY 2,400.00 |
|
RC221455L1 | Lenti ORF clone of Human hairy and enhancer of split 2 (Drosophila) (HES2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC221455L2 | Lenti ORF clone of Human hairy and enhancer of split 2 (Drosophila) (HES2), mGFP tagged |
CNY 5,890.00 |
|
RC221455L3 | Lenti ORF clone of Human hairy and enhancer of split 2 (Drosophila) (HES2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221455L4 | Lenti ORF clone of Human hairy and enhancer of split 2 (Drosophila) (HES2), mGFP tagged |
CNY 5,890.00 |
|
RG221455 | HES2 (tGFP-tagged) - Human hairy and enhancer of split 2 (Drosophila) (HES2) |
CNY 4,370.00 |