Kallikrein 12 (KLK12) (NM_019598) Human Untagged Clone
CAT#: SC304679
KLK12 (untagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KLK-L5; KLKL5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_019598 edited
GGAAGTGACCCACCATGGGGCTCAGCATCTTTTTGCTCCTGTGTGTTCTTGGGCTCAGCC AGGCAGCCACACCGAAGATTTTCAATGGCACTGAGTGTGGGCGTAACTCACAGCCGTGGC AGGTGGGGCTGTTTGAGGGCACCAGCCTGCGCTGCGGGGGTGTCCTTATTGACCACAGGT GGGTCCTCACAGCGGCTCACTGCAGCGGCAGCAGGTACTGGGTGCGCCTGGGGGAACACA GCCTCAGCCAGCTCGACTGGACCGAGCAGATCCGGCACAGCGGCTTCTCTGTGACCCATC CCGGCTACCTGGGAGCCTCGACGAGCCACGAGCACGACCTCCGGCTGCTGCGGCTGCGCC TGCCCGTCCGCGTAACCAGCAGCGTTCAACCCCTGCCCCTGCCCAATGACTGTGCAACCG CTGGCACCGAGTGCCACGTCTCAGGCTGGGGCATCACCAACCACCCACGGAACCCATTCC CGGATCTGCTCCAGTGCCTCAACCTCTCCATCGTCTCCCATGCCACCTGCCATGGTGTGT ATCCCGGGAGAATCACGAGCAACATGGTGTGTGCAGGCGGCGTCCCGGGGCAGGATGCCT GCCAGGGTGATTCTGGGGGCCCCCTGGTGTGTGGGGGAGTCCTTCAAGGTCTGGTGTCCT GGGGGTCTGTGGGGCCCTGTGGACAAGATGGCATCCCTGGAGTCTACACCTATATTTGCA ACTCCACTCTTGTTGGCCTGGGAACTTCTTGGAACTTTAACTCCTGCCAGCCCTTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_019598 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It is not a varient. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019598.2, NP_062544.1 |
RefSeq Size | 945 bp |
RefSeq ORF | 765 bp |
Locus ID | 43849 |
UniProt ID | Q9UKR0 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform of this protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220158 | KLK12 (Myc-DDK-tagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 1 |
CNY 2,400.00 |
|
RC220158L1 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC220158L2 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC220158L3 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220158L4 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG220158 | KLK12 (tGFP-tagged) - Human kallikrein-related peptidase 12 (KLK12), transcript variant 1 |
CNY 4,000.00 |
其它Kallikrein 12产品