United States
Germany
Japan
United Kingdom
China
KIR2DL5A (NM_020535) Human Untagged Clone
CAT＃: SC304783
KIR2DL5A (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A)
CNY 6,080.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD158F; KIR2DL5; KIR2DL5.1; KIR2DL5.3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_020535 edited
GAATTCCAGCACCATGTCGCTCATGGTCATCAGCATGGCGTGTGTTGGGTTCTTCTTGCT GCAGGGGGCCTGGACACATGAGGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAG CGCTGTGGTGCCTCGAGGAGGACATGTGACTCTTCTGTGTCGCTCTCGTCTTGGGTTTAC CATCTTCAGTCTGTACAAAGAAGATGGGGTGCCTGTCCCTGAGCTCTACAACAAAATATT CTGGAAGAGCATCCTCATGGGCCCTGTGACCCCTGCACACGCAGGGACCTACAGATGTCG GGGTTCACACCCACGCTCCCCCATTGAGTGGTCAGCACCCAGCAACCCCCTGGTGATCGT GGTCACAGGTCTATTTGGGAAACCTTCACTCTCAGCCCAGCCGGGCCCCACGGTTCGCAC AGGAGAGAACGTGACCTTGTCCTGCAGCTCCAGGAGCTCATTTGACATGTACCATCTATC CAGGGAGGGGAGGGCCCATGAACCTAGGCTCCCTGCAGTGCCCAGCGTCAATGGAACATT CCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACACATGCTTCGGCTC TCTCCATGACTCACCCTATGAGTGGTCAGACCCGAGTGACCCACTGCTTGTTTCTGTCAC AGGAAACTCTTCAAGTAGTTCATCTTCACCCACTGAACCAAGCTCCAAAACTGGTATCCG CAGACACCTGCACATTCTGATTGGGACCTCAGTGGCTATCATCCTCTTCATCATCCTCTT CTTCTTTCTCCTTCATTGCTGCTGCTCCAACAAAAAGAATGCTGCTGTAATGGACCAAGA GCCTGCCGGGGACAGAACAGTGAACAGGGAGGACTCTGATGATCAAGACCCTCAGGAGGT GACATATGCACAGTTGGATCACTGCGTTTTCACACAGACAAAAATCACTTCCCCTTCTCA GAGGCCCAAGACACCTCCAACAGATACCACCATGTACATGGAACTTCCAAATGCTAAGCC AAGATCATTGTCTCCTGCCCATAAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGA GACAACAGCCCTGTCTCAAAACCGGGTTGCTAGCTCCCATGTACCAGCAGCTGGAATCTG ATCTAGA |
| Restriction Sites | Please inquire |
| ACCN | NM_020535 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_020535.3, NP_065396.1 |
| RefSeq Size | 1596 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 57292 |
| UniProt ID | Q8N109 |
| Protein Families | Transmembrane |
| Protein Pathways | Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity |
| Gene Summary | Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217119 | KIR2DL5A (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A) |
CNY 3,656.00 |
|
| RC217119L1 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217119L2 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A), mGFP tagged |
CNY 5,890.00 |
|
| RC217119L3 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217119L4 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A), mGFP tagged |
CNY 5,890.00 |
|
| RG217119 | KIR2DL5A (tGFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5A (KIR2DL5A) |
CNY 4,370.00 |
其它KIR2DL5A产品
