United States
Germany
Japan
United Kingdom
China
IFNA4 (NM_021068) Human Untagged Clone
CAT＃: SC304903
IFNA4 (untagged)-Human interferon, alpha 4 (IFNA4)
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IFN-alpha4a; INFA4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304903 representing NM_021068.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGC TGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGCACAAATGGGAAGA ATCTCTCATTTCTCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCAC CAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGC ACAGAGGACTCATCTGCTGCTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAA CTGAATGACCTGGAAGCATGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGAC TCCATCCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAACAGAGAAGAAATACAGCCCT TGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCGTTTTCAACAAACTTGCAAAAAAGA TTAAGGAGGAAGGATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021068 |
| Insert Size | 570 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021068.2 |
| RefSeq Size | 982 bp |
| RefSeq ORF | 570 bp |
| Locus ID | 3441 |
| UniProt ID | P05014 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway |
| MW | 21.8 kDa |
| Gene Summary | Produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Clinical and immunological characteristics of Autoimmune Addison's disease: a nationwide Swedish multicenter study
,Dalin, F;Nordling Eriksson, G;Dahlqvist, P;Hallgren, Å;Wahlberg, J;Ekwall, O;Söderberg, S;Rönnelid, J;Olcén, P;Winqvist, O;Catrina, SB;Kriström, B;Laudius, M;Isaksson, M;Halldin Stenlid, M;Gustafsson, J;Gebre-Medhin, G;Björnsdottir, S;Janson, A;Åkerman, AK;Åman, J;Duchen, K;Bergthorsdottir, R;Johannsson, G;Lindskog, E;Landin-Olsson, M;Elfving, M;Waldenström, E;Hulting, AL;Kämpe, O;Bensing, S;,
J. Clin. Endocrinol. Metab.
,PubMed ID 27870550
[IFNA4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223649 | IFNA4 (Myc-DDK-tagged)-Human interferon, alpha 4 (IFNA4) |
CNY 3,600.00 |
|
| RC223649L1 | Lenti ORF clone of Human interferon, alpha 4 (IFNA4), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC223649L2 | Lenti ORF clone of Human interferon, alpha 4 (IFNA4), mGFP tagged |
CNY 5,890.00 |
|
| RC223649L3 | Lenti ORF clone of Human interferon, alpha 4 (IFNA4), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC223649L4 | Lenti ORF clone of Human interferon, alpha 4 (IFNA4), mGFP tagged |
CNY 5,890.00 |
|
| RG223649 | IFNA4 (tGFP-tagged) - Human interferon, alpha 4 (IFNA4) |
CNY 5,200.00 |
