United States
Germany
Japan
United Kingdom
China
ALX4 (NM_021926) Human Untagged Clone
CAT＃: SC304972
ALX4 (untagged)-Human ALX homeobox 4 (ALX4)
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CRS5; FND2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_021926 edited
CAGGCATGAATGCTGAGACTTGCGTCTCTTACTGCGAGTCGCCGGCCGCTGCCATGGACG CCTACTACAGCCCGGTGTCGCAGAGTCGGGAGGGCTCGTCGCCTTTTAGGGCATTTCCCG GAGGCGACAAGTTCGGCACAACTTTCCTGTCGGCCGCCGCCAAAGCACAGGGATTCGGGG ACGCCAAGAGCCGGGCCCGTTACGGCGCTGGGCAGCAGGACCTGGCGACACCCCTGGAGA GTGGAGCTGGGGCGCGGGGCTCCTTTAACAAGTTCCAGCCCCAGCCGTCGACCCCGCAGC CCCAGCCGCCGCCGCAGCCGCAGCCGCAGCAGCAGCAGCCGCAGCCCCAGCCGCCCGCGC AACCGCATCTTTACTTGCAGCGAGGCGCCTGCAAGACGCCCCCGGACGGCAGCCTCAAAC TCCAGGAAGGCAGCAGCGGCCACAGCGCGGCCTTGCAGGTTCCCTGCTACGCTAAAGAGA GCTCCCTGGGTGAGCCAGAGTTACCCCCTGACTCTGACACTGTGGGGATGGACAGCAGCT ACCTGAGTGTCAAGGAGGCTGGGGTGAAGGGGCCCCAGGACCGGGCCAGCTCAGACCTCC CCAGCCCATTGGAGAAGGCCGACTCAGAGAGCAACAAGGGCAAGAAGCGGCGGAACCGGA CCACCTTCACCAGCTACCAGCTGGAGGAGCTGGAGAAGGTCTTCCAGAAGACCCACTACC CAGACGTGTATGCGCGGGAACAGCTGGCCATGAGGACAGACCTCACTGAGGCCCGCGTGC AGGTCTGGTTCCAGAACCGAAGGGCCAAGTGGAGGAAGCGGGAGCGTTTTGGGCAGATGC AGCAGGTTCGAACCCACTTCTCCACTGCATATGAGCTGCCCCTCCTCACCCGAGCTGAGA ACTACGCCCAGATTCAGAACCCGTCCTGGCTCGGCAACAACGGGGCTGCCTCACCAGTGC CAGCCTGCGTGGTCCCCTGCGACCCGGTGCCTGCCTGCATGTCCCCTCATGCCCACCCCC CTGGCTCTGGGGCCAGCAGCGTCACCGACTTCCTGAGTGTGTCTGGGGCTGGCAGTCACG TGGGCCAGACGCACATGGGCAGCCTGTTTGGAGCAGCCAGCCTCAGCCCAGGCCTCAATG GCTACGAGCTCAACGGCGAGCCGGACCGCAAGACCTCGAGCATCGCGGCCCTCCGCATGA AGGCCAAGGAGCACAGTGCGGCCATTTCCTGGGCCACATGATCTAGA |
| Restriction Sites | Please inquire |
| ACCN | NM_021926 |
| Insert Size | 1250 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021026.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_021926.2, NP_068745.2 |
| RefSeq Size | 1586 bp |
| RefSeq ORF | 1236 bp |
| Locus ID | 60529 |
| UniProt ID | Q9H161 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, cognitive disability, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224459 | ALX4 (Myc-DDK-tagged)-Human ALX homeobox 4 (ALX4) |
CNY 5,488.00 |
|
| RC224459L1 | Lenti ORF clone of Human ALX homeobox 4 (ALX4), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC224459L2 | Lenti ORF clone of Human ALX homeobox 4 (ALX4), mGFP tagged |
CNY 7,888.00 |
|
| RC224459L3 | Lenti ORF clone of Human ALX homeobox 4 (ALX4), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC224459L4 | Lenti ORF clone of Human ALX homeobox 4 (ALX4), mGFP tagged |
CNY 7,888.00 |
|
| RG224459 | ALX4 (tGFP-tagged) - Human ALX homeobox 4 (ALX4) |
CNY 7,088.00 |
