CHP2 (NM_022097) Human Untagged Clone
CAT#: SC304990
CHP2 (untagged)-Human calcineurin B homologous protein 2 (CHP2)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304990 representing NM_022097.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGTCGCGCAGCTCCCACGCCGCGGTCATTCCCGACGGGGACAGTATTCGGCGAGAGACCGGCTTC TCCCAAGCCAGCCTGCTCCGCCTGCACCACCGGTTCCGGGCACTGGACAGGAATAAGAAGGGCTACCTG AGCCGCATGGATCTCCAGCAGATAGGGGCGCTCGCCGTGAACCCCCTGGGAGACCGAATTATAGAAAGC TTCTTCCCCGATGGGAGCCAGCGAGTGGATTTCCCAGGCTTTGTCAGGGTCTTGGCTCATTTTCGCCCT GTAGAAGATGAGGACACAGAAACCCAAGACCCCAAGAAACCTGAACCTCTCAACAGCAGAAGGAACAAA CTTCACTATGCATTTCAGCTCTATGACCTGGATCGCGATGGGAAGATCTCCAGGCATGAGATGCTGCAG GTTCTCCGTCTGATGGTTGGGGTACAGGTGACAGAAGAGCAGCTGGAGAACATCGCTGACCGCACGGTG CAGGAGGCTGATGAAGATGGGGATGGGGCTGTGTCCTTCGTGGAGTTCACCAAGTCCTTAGAGAAGATG GACGTTGAGCAAAAAATGAGCATCCGGATCCTGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022097 |
Insert Size | 591 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022097.3 |
RefSeq Size | 2389 bp |
RefSeq ORF | 591 bp |
Locus ID | 63928 |
UniProt ID | O43745 |
Protein Pathways | Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Axon guidance, B cell receptor signaling pathway, Calcium signaling pathway, Long-term potentiation, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Oocyte meiosis, T cell receptor signaling pathway, VEGF signaling pathway, Wnt signaling pathway |
MW | 22.5 kDa |
Gene Summary | This gene product is a small calcium-binding protein that regulates cell pH by controlling plasma membrane-type Na+/H+ exchange activity. This protein shares sequence similarity with calcineurin B and can bind to and stimulate the protein phosphatase activity of calcineurin A (CnA) and functions in the calcineurin/NFAT (nuclear factor of activated T cells) signaling pathway. Another member of the CHP subfamily, Calcineurin B homologous protein 1, is located on Chromosome 15 and is an inhibitor of calcineurin activity and has a genetic phenotype associated with Parkinson's Disease (OMIM:606988). This gene was initially identified as a tumor-associated antigen and was previously referred to as Hepatocellular carcinoma-associated antigen 520. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212776 | CHP2 (Myc-DDK-tagged)-Human calcineurin B homologous protein 2 (CHP2) |
CNY 2,400.00 |
|
RC212776L3 | Lenti ORF clone of Human calcineurin B homologous protein 2 (CHP2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212776L4 | Lenti ORF clone of Human calcineurin B homologous protein 2 (CHP2), mGFP tagged |
CNY 5,890.00 |
|
RG212776 | CHP2 (tGFP-tagged) - Human calcineurin B homologous protein 2 (CHP2) |
CNY 4,370.00 |