PHOS (PDC) (NM_022576) Human Untagged Clone
CAT#: SC305039
PDC (untagged)-Human phosducin (PDC), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MEKA; PHD; PhLOP; PhLP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305039 representing NM_022576.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTTCTCCTCAGAGTAGGAATGGCAAAGATTCAAAGGAACGAGTCAGCAGAAAGATGAGCATTCAA GAATATGAACTAATCCATAAAGAGAAAGAGGATGAAAACTGCCTTCGTAAATACCGTAGACAGTGTATG CAGGATATGCACCAGAAGCTGAGTTTTGGGCCTAGATATGGGTTTGTGTATGAGCTGGAAACTGGAAAG CAATTCCTAGAAACAATTGAAAAGGAACTGAAGATCACCACAATTGTTGTTCACATTTATGAAGATGGT ATTAAGGGTTGTGATGCTCTAAACAGTAGTTTAACATGCCTTGCAGCAGAATACCCTATAGTTAAGTTT TGTAAAATAAAAGCTTCGAATACAGGTGCTGGGGACCGCTTTTCCTTAGATGTACTTCCTACACTGCTC ATCTATAAAGGTGGGGAACTCATAAGCAATTTTATTAGTGTTGCTGAACAGTTTGCTGAAGAATTTTTT GCTGGGGATGTGGAGTCTTTCCTAAATGAATATGGGTTACTACCTGAAAGAGAGGTACATGTCCTAGAG CATACCAAAATAGAAGAAGAAGATGTTGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022576 |
Insert Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022576.3 |
RefSeq Size | 1208 bp |
RefSeq ORF | 585 bp |
Locus ID | 5132 |
UniProt ID | P20941 |
Protein Families | Druggable Genome |
Protein Pathways | Olfactory transduction |
MW | 22.3 kDa |
Gene Summary | This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as PHLOP1, has an alternate 5' sequence, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212016 | PDC (Myc-DDK-tagged)-Human phosducin (PDC), transcript variant 2 |
CNY 2,400.00 |
|
RC212016L3 | Lenti ORF clone of Human phosducin (PDC), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212016L4 | Lenti ORF clone of Human phosducin (PDC), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212016 | PDC (tGFP-tagged) - Human phosducin (PDC), transcript variant 2 |
CNY 4,370.00 |