GPR157 (NM_024980) Human Untagged Clone
CAT#: SC305203
GPR157 (untagged)-Human G protein-coupled receptor 157 (GPR157)
CNY 3,656.00
CNY 5,420.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene SC305203 ORF sequence for NM_024980, the custom clone sequence may differ by one or more nucleotides
ATGCAGCCGTCCCCGCCGCCCACCGAGCTGGTGCCGTCGGAGCGCGCCGTGGTGCTGCTGTCGTGCGCAC TCTCCGCGCTCGGCTCGGGCCTGCTGGTGGCCACGCACGCCCTGTGGCCCGACCTGCGCAGCCGGGCACG GCGCCTGCTGCTCTTCCTGTCGCTGGCCGACCTGCTCTCGGCCGCCTCCTACTTCTACGGAGTGCTGCAG AACTTCGCGGGCCCGTCGTGGGACTGCGTGCTGCAGGGCGCGCTGTCCACCTTCGCCAACACCAGCTCCT TCTTCTGGACCGTGGCCATTGCGCTCTACTTGTACCTCAGCATCGTCCGCGCCGCGCGCGGGCCTCGCAC AGATCGCCTGCTTTGGGCCTTCCATGTCGTCAGCTGGGGGGTCCCGTTGGTCATCACTGTGGCGGCCGTC GCCCTGAAGAAGATTGGCTATGACGCCTCGGACGTGTCTGTGGGCTGGTGCTGGATCGACCTGGAGGCCA AGGACCATGTCCTGTGGATGCTGCTGACGGGGAAGCTGTGGGAGATGCTGGCATATGTGCTGCTGCCTCT GCTGTACCTCCTGGTCCGGAAGCACATCAACAGAGCGCACACGGCACTCTNTGAGTACCGGCCCATCCTC TCCCAGGAGCACCGCCTGSTGCGCCACTCCTCCATGGCGGACAAGAAGCTGGTGCTCATCCCGCTCATCT TCATCGGCCTCAGGGTCTGGAGCACCGTGCGGTTCGTGCTGACCCTCTGTGGCTCCCCGGCCGTGCAGAC GCCGGTGCTGGTGGTTCTGCATGGTATCGGGAACACGTTTCAGGGAGGTGCCAACTGCATCATGTTCGTC CTCTGCACCCGCGCCGTCCGAACTCGGCTCTTCTCTCTCTGTTGCTGCTGCTGCTCTTCTCAGCCTCCCA CCAAGAGCCCGGCTGGCACTCCCAAGGCTCCCGCGCCTTCCAAGCCAGGAGAATCTCAGGAATCCCAAGG GACCCCAGGGGAACTTCCAAGCACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024980 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024980.3, NP_079256.3 |
RefSeq Size | 1153 bp |
RefSeq ORF | 1008 bp |
Locus ID | 80045 |
UniProt ID | Q5UAW9 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Orphan receptor that promotes neuronal differentiation of radial glial progenitors (RGPs). The activity of this receptor is mediated by a G(q)-protein that activates a phosphatidylinositol-calcium second messenger.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221593 | GPR157 (Myc-DDK-tagged)-Human G protein-coupled receptor 157 (GPR157) |
CNY 3,656.00 |
|
RC221593L3 | Lenti ORF clone of Human G protein-coupled receptor 157 (GPR157), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221593L4 | Lenti ORF clone of Human G protein-coupled receptor 157 (GPR157), mGFP tagged |
CNY 5,890.00 |
|
RG221593 | GPR157 (tGFP-tagged) - Human G protein-coupled receptor 157 (GPR157) |
CNY 4,370.00 |