FTHL17 (NM_031894) Human Untagged Clone
CAT#: SC305357
FTHL17 (untagged)-Human ferritin, heavy polypeptide-like 17 (FTHL17)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT38 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_031894 edited
CCCGCCTTTCACTATCCGCCATTCTTGTCACCTCAGCTGCTGCCCTCGCTACCGCACCGA CTTCGCCCGTGTGCTCGCCTGCACTTGCGCTGCCCGCCATGGCCACCGCCCAGCCGTCGC AGGTGCGCCAGAAGTACGACACCAACTGCGACGCCGCCATCAACAGCCACATCACGCTGG AGCTCTACACCTCCTACCTGTACCTGTCTATGGCCTTCTACTTCAACCGGGACGACGTGG CCCTGGAGAACTTCTTCCGCTACTTCCTGCGCCTGTCGGACGACAAAATGGAGCATGCCC AGAAGCTGATGAGGCTGCAGAACCTGCGCGGTGGCCACATCTGCCTTCACGATATCAGGA AGCCAGAGTGCCAAGGCTGGGAGAGCGGGCTCGTGGCCATGGAGTCCGCCTTCCACCTGG AGAAGAACGTCAACCAGAGCCTGCTGGATCTGTACCAGCTGGCCGTGGAGAAGGGCGACC CCCAGCTGTGCCACTTCCTGGAGAGCCACTACCTGCACGAGCAAGTCAAGACCATCAAAG AGCTGGGTGGCTACGTGAGCAACCTGCGCAAGATTTGTTCCCCGGAAGCCGGCCTGGCTG AGTACCTGTTCGACAAGCTCACCCTGGGCGGCCGCGTCAAAGAGACTTGAGCCCAGATGG GCCCCACAGCCACGGGGTCCCTTCCCTGGGTCAGGCCACTAGGCGGGGCGTGCATGTTGC CCTTTCAGAACGTTCTCTTCAGTTTTATCTTTCAGTTTTACCATTGTTAGCAAAAAAGTT ATCTGGTTCTCAAAGCAATAAAGGTGTCCA |
Restriction Sites | Please inquire |
ACCN | NM_031894 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_031894.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031894.1, NP_114100.1 |
RefSeq Size | 833 bp |
RefSeq ORF | 552 bp |
Locus ID | 53940 |
UniProt ID | Q9BXU8 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a ferritin heavy chain-like protein. This gene is primarily expressed in embryonic germ cells. The encoded protein may lack ferroxidase activity. Multiple pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Oct 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214888 | FTHL17 (Myc-DDK-tagged)-Human ferritin, heavy polypeptide-like 17 (FTHL17) |
CNY 2,400.00 |
|
RC214888L3 | Lenti ORF clone of Human ferritin, heavy polypeptide-like 17 (FTHL17), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214888L4 | Lenti ORF clone of Human ferritin, heavy polypeptide-like 17 (FTHL17), mGFP tagged |
CNY 5,890.00 |
|
RG214888 | FTHL17 (tGFP-tagged) - Human ferritin, heavy polypeptide-like 17 (FTHL17) |
CNY 4,000.00 |