IDI2 (NM_033261) Human Untagged Clone

CAT#: SC305604

IDI2 (untagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2)



  "NM_033261" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IDI2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IPPI2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305604 representing NM_033261.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGACATAAATCTTGACTGGGTTGACAGGCGTCAGTTGCAGCGCTTGGAGGAAATGCTGATTGTT
GTGGATGAGAATGATAAGGTTATTGGTGCCGACACCAAGAGGAATTGCCATCTGAACGAAAACATTGAG
AAAGGGCTGCTGCACCGAGCCTTCAGCGTTGTCTTGTTTAACACCAAGAATCGAATCCTGATACAGCAG
AGGTCGGACACGAAAGTCACGTTTCCTGGGTATTTTACCGACTCCTGTAGTAGCCACCCATTATACAAC
CCAGCAGAACTGGAAGAAAAGGATGCCATCGGAGTGAGGAGGGCAGCCCAGAGGCGTCTGCAAGCAGAG
CTGGGAATTCCTGGGGAGCAGATTTCTCCAGAGGACATTGTGTTCATGACAATCTATCACCACAAGGCA
AAATCAGACAGAATTTGGGGAGAGCATGAAATTTGTTACCTTCTGCTTGTGAGGAAAAACGTCACTCTG
AACCCGGATCCCAGTGAAACGAAAAGCATCCTCTACCTGTCCCAGGAGGAGCTGTGGGAGCTGCTGGAG
AGGGAGGCGAGGGGTGAAGTCAAAGTCACCCCCTGGCTAAGAACCATTGCCGAGAGGTTTCTGTACCGG
TGGTGGCCTCACCTGGATGACGTGACCCCGTTTGTGGAGCTTCACAAAATACACAGAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033261
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033261.2
RefSeq Size 1359 bp
RefSeq ORF 684 bp
Locus ID 91734
UniProt ID Q9BXS1
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
MW 26.8 kDa
Gene Summary The protein encoded by this gene catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate, which is a precursor for the synthesis of cholesterol and other isoprenoids. This gene, which is a product of an ancestral gene duplication event, encodes a protein that may be involved in the aggregation of alpha-synuclein in the cerebral cortex of patients with Lewy body disease. In addition, segmental copy number gains in this locus have been associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...