CIB3 (NM_054113) Human Untagged Clone
CAT#: SC305734
CIB3 (untagged)-Human calcium and integrin binding family member 3 (CIB3)
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KIP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305734 representing NM_054113.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCAACAAGCAGACAGTCTTCACACACGAGCAGCTGGAAGCGTATCAGGACTGCACATTTTTCACA AGGAAGGAGATCATGAGGCTCTTCTATCGCTACCAGGACCTGGCCCCACAGCTCGTGCCCCTCGACTAT ACCACCTGCCCCGATGTGAAGGTGCCCTACGAGCTCATTGGCAGCATGCCCGAGCTGAAGGACAACCCC TTCCGCCAGAGGATTGCCCAGGTATTCTCTGAGGATGGGGATGGCCACATGACCCTGGACAACTTTTTG GACATGTTTTCCGTGATGAGTGAAATGGCTCCCCGCGACCTCAAGGCTTACTATGCTTTTAAAATTTAT GATTTTAACAACGACGACTACATTTGTGCGTGGGACCTGGAGCAGACGGTGACCAAACTGACGCGGGGG GGGCTGAGTGCCGAGGAGGTGAGCCTGGTATGTGAGAAGGTGCTGGATGAGGCTGATGGAGACCATGAT GGGCGGCTGTCCCTGGAAGATTTCCAGAACATGATCCTCCGGGCACCAGACTTCCTCAGCACCTTCCAC ATCCGAATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_054113 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_054113.3 |
RefSeq Size | 725 bp |
RefSeq ORF | 564 bp |
Locus ID | 117286 |
UniProt ID | Q96Q77 |
Protein Families | Druggable Genome |
MW | 21.8 kDa |
Gene Summary | This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216582 | CIB3 (Myc-DDK-tagged)-Human calcium and integrin binding family member 3 (CIB3) |
CNY 2,400.00 |
|
RC216582L3 | Lenti ORF clone of Human calcium and integrin binding family member 3 (CIB3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216582L4 | Lenti ORF clone of Human calcium and integrin binding family member 3 (CIB3), mGFP tagged |
CNY 5,890.00 |
|
RG216582 | CIB3 (tGFP-tagged) - Human calcium and integrin binding family member 3 (CIB3) |
CNY 4,000.00 |