DNASE2B (NM_058248) Human Untagged Clone
CAT#: SC305776
DNASE2B (untagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DLAD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_058248, the custom clone sequence may differ by one or more nucleotides
ATGCCCCAGCTGTGCACCAGGGCCAGCTCATCAGAGATTCCTGGCAGGCTCCTCACCACA CTTCAGTCGGCCCAGGGACAAAAATTCCTCCATTTTGCAAAGTCGGATTCTTTTCTTGAC GACATCTTTGCAGCCTGGATGGCTCAACGGCTGAAGACACACTTGTTAACAGAAACCTGG CAGCGAAAAAGACAAGAGCTTCCTTCAAACTGCTCCCTTCCTTACCATGTCTACAATATA AAAGCAATTAAATTATCACGACACTCTTATTTCAGTTCTTATCAAGATCATGCCAAGTGG TGTATTTCCCAAAAGGGCACCAAAAATCGCTGGACATGTATTGGAGACCTAAATCGGAGT CCACACCAAGCCTTCAGAAGTGGAGGATTCATTTGTACCCAGAATTGGCAAATTTACCAA GCATTTCAAGGATTAGTATTATACTATGAAAGCTGTAAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_058248 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_058248.1, NP_490649.1 |
RefSeq Size | 1029 bp |
RefSeq ORF | 462 bp |
Locus ID | 58511 |
UniProt ID | Q8WZ79 |
Protein Families | Transmembrane |
Protein Pathways | Lysosome |
Gene Summary | The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks the first two exons present in transcript variant 1. However, it maintains the same reading frame and encodes an isoform (2) which is truncated at the N-terminus compared to isoform 1. Isoform 2 is specifically expressed in the lungs. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214291 | DNASE2B (Myc-DDK-tagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 2 |
CNY 3,990.00 |
|
RC214291L3 | Lenti-ORF clone of DNASE2B (Myc-DDK-tagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 2 |
CNY 5,890.00 |
|
RC214291L4 | Lenti-ORF clone of DNASE2B (mGFP-tagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 2 |
CNY 5,890.00 |
|
RG214291 | DNASE2B (tGFP-tagged) - Human deoxyribonuclease II beta (DNASE2B), transcript variant 2 |
CNY 4,370.00 |
其它DNASE2B产品