TOR2A (NM_130459) Human Untagged Clone
CAT#: SC305891
TOR2A (untagged)-Human torsin family 2, member A (TOR2A), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TORP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_130459, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCTGCGACGCGCGGCTGCCGGCCCTGGGGCTCGCTCCTCGGGCTGCTCGGGCTG GTCTCGGCCGCGGCCGCCGCCTGGGACCTGGCTTCCCTGCGCTGCACCTTGGGCGCCTTT TGCGAATGCGACTTCCGGCCCGACTTGCCGGGTCTGGAGTGTGACCTGGCTCAGCACCTG GCCGGCCAGCATCTGGCCAAGGCGCTGGTGGTGAAGGCGCTGAAGGCCTTTGTGCGGGAC CCAGCCCCCACCAAGCCGCTGGTCCTCTCCCTGCACGGCTGGACCGGCACCGGCAAATCC TATGTCAGCTCCCTGCTGGCGCACTACCTCTTCCAGGGCGGCCTCCGCAGCCCCCGCGTG CACCACTTTTCTCCCGTCCTCCACTTCCCCCACCCCAGCCACATCGAGCGCTACAAGAAG GATCTGAAGAGCTGGGTCCAAGGGAACCTCACTGCCTGTGGCCGCTCCCTCTTCCTCTTC GATGAGATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCC TCCTGGGTGGTATACGGGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGGTGGGGC CCGGCTTTGCAGTGGGCACAGTGGGGGGGCCACTTCTCAGAGGTTCAGCTCTACAGCCTT AGCCTGTGCTCCCAGCAGAATCCAGTTCCCCATGGGCTTAGCTGGGCTTTCCCAGTGCCC TCCGCCACTCTCAGAGATGACATTGTCATTCCGCCTGGTTGA |
Restriction Sites | Please inquire |
ACCN | NM_130459 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_130459.1, NP_569726.1 |
RefSeq Size | 2467 bp |
RefSeq ORF | 762 bp |
Locus ID | 27433 |
UniProt ID | Q5JU69 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (2) lacks two splice sites in the 3' region, resulting in a frameshift and longer 3' UTR, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218493 | TOR2A (Myc-DDK-tagged)-Human torsin family 2, member A (TOR2A), transcript variant 2 |
CNY 3,990.00 |
|
RC218493L3 | Lenti-ORF clone of TOR2A (Myc-DDK-tagged)-Human torsin family 2, member A (TOR2A), transcript variant 2 |
CNY 5,890.00 |
|
RC218493L4 | Lenti-ORF clone of TOR2A (mGFP-tagged)-Human torsin family 2, member A (TOR2A), transcript variant 2 |
CNY 5,890.00 |
|
RG218493 | TOR2A (tGFP-tagged) - Human torsin family 2, member A (TOR2A), transcript variant 2 |
CNY 4,370.00 |