GSH2 (GSX2) (NM_133267) Human Untagged Clone

CAT#: SC305940

GSX2 (untagged)-Human GS homeobox 2 (GSX2)



  "NM_133267" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GSH2 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DMJDS2; GSH2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_133267, the custom clone sequence may differ by one or more nucleotides


ATGTCGCGCTCCTTCTATGTCGACTCGCTCATCATCAAGGACACCTCACGGCCTGCGCCCTCGCTGCCTG
AACCGCACCCCGGGCCGGATTTCTTCATCCCGCTTGGCATGCCGCCCCCATTGGTGATGTCCGTGTCCGG
CCCCGGCTGCCCGTCCCGCAAGAGCGGCGCGTTCTGCGTGTGCCCTCTCTGCGTCACTTCGCACCTGCAC
TCCTCTCGGGGGTCTGTGGGCGCCGGCAGCGGGGGCGCAGGGGCCGGGGTTACCGGGGCCGGAGGCAGTG
GGGTGGCAGGGGCCGCAGGGGCACTGCCTCTGCTTAAGAGCCAGTTCTCTTCGGCTCCTGGGGACGCGCA
GTTTTGCCCGCGGGTGAACCATGCGCATCATCACCACCACCCGCCGCAGCACCACCATCACCATCATCAG
CCCCAGCAGCCTGGCTCGGCCGCGGCGGCGGCAGCAGCAGCAGCGGCGGCGGCGGCCGCGGCGGCCTTGG
GGCACCCGCAGCACCACGCACCTGTCTGCACCGCCACCACCTACAACGTGGCGGACCCGCGGAGATTCCA
CTGCCTCACCATGGGAGGCTCTGACGCCAGCCAGGTACCCAATGGCAAGAGGATGAGGACGGCGTTCACT
AGCACGCAACTCCTGGAGCTGGAGAGAGAATTCTCTTCCAACATGTACCTGTCTCGACTCCGGAGGATTG
AAATCGCCACTTACCTGAACCTGTCGGAGAAGCAGGTGAAAATCTGGTTTCAGAACCGCCGAGTGAAGCA
CAAGAAGGAGGGGAAGGGCACGCAGAGGAACAGTCACGCGGGCTGCAAGTGCGTCGGGAGCCAGGTGCAC
TACGCGCGCTCCGAGGATGAGGACTCCCTGTCGCCGGCCTCAGCCAACGATGACAAGGAGATTTCCCCCT
TATGA


Restriction Sites Please inquire     
ACCN NM_133267
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133267.1, NP_573574.1
RefSeq Size 1262 bp
RefSeq ORF 915 bp
Locus ID 170825
UniProt ID Q9BZM3
Gene Summary During telencephalic development, causes ventralization of pallial progenitors and, depending on the developmental stage, specifies different neuronal fates. At early stages, necessary and sufficient to correctly specify the ventral lateral ganglionic eminence (LGE) and its major derivatives, the striatal projection neurons. At later stages, may specify LGE progenitors toward dorsal LGE fates, including olfactory bulb interneurons (By similarity). Transcription factor that binds 5'-CNAATTAG-3' DNA sequence.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...