ASAH3 (ACER1) (NM_133492) Human Untagged Clone

CAT#: SC305969

ACER1 (untagged)-Human alkaline ceramidase 1 (ACER1)



  "NM_133492" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ACER1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALKCDase1; ASAH3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305969 representing NM_133492.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTAGCATCTTCGCCTATCAGAGCTCCGAGGTGGACTGGTGTGAGAGCAACTTCCAGTACTCGGAG
CTGGTGGCCGAGTTCTACAACACGTTCTCCAATATCCCCTTCTTCATCTTCGGGCCACTGATGATGCTC
CTGATGCACCCGTATGCCCAGAAGCGCTCCCGCTACATTTACGTTGTCTGGGTCCTCTTCATGATCATA
GGCCTGTTCTCCATGTATTTCCACATGACGCTCAGCTTCCTGGGCCAGCTGCTGGACGAGATCGCCATC
CTGTGGCTCCTGGGCAGTGGCTATAGCATATGGATGCCCCGCTGCTATTTCCCCTCCTTCCTTGGGGGG
AACAGGTCCCAGTTCATCCGCCTGGTCTTCATCACCACTGTGGTCAGCACCCTTCTGTCCTTCCTGCGG
CCCACGGTCAACGCCTACGCCCTCAACAGCATTGCCCTGCACATTCTCTACATCGTGTGCCAGGAGTAC
AGGAAGACCAGCAATAAGGAGCTTCGGCACCTGATTGAGGTCTCCGTGGTTTTATGGGCTGTTGCTCTG
ACCAGCTGGATCAGTGACCGTCTGCTTTGCAGCTTCTGGCAGAGGATTCATTTCTTCTATCTGCACAGC
ATCTGGCATGTGCTCATCAGCATCACCTTCCCTTATGGCATGGTCACCATGGCCTTGGTGGATGCCAAC
TATGAGATGCCAGGTGAAACCCTCAAAGTCCGCTACTGGCCTCGGGACAGTTGGCCCGTGGGGCTGCCC
TACGTGGAAATCCGGGGTGATGACAAGGACTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_133492
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133492.2
RefSeq Size 1088 bp
RefSeq ORF 795 bp
Locus ID 125981
UniProt ID Q8TDN7
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Sphingolipid metabolism
MW 31.1 kDa
Gene Summary Ceramides are synthesized during epidermal differentiation and accumulate within the interstices of the stratum corneum, where they represent critical components of the epidermal permeability barrier. Excess cellular ceramide can trigger antimitogenic signals and induce apoptosis, and the ceramide metabolites sphingosine and sphingosine-1-phosphate (S1P) are important bioregulatory molecules. Ceramide hydrolysis in the nucleated cell layers regulates keratinocyte proliferation and apoptosis in response to external stress. Ceramide hydrolysis also occurs at the stratum corneum, releasing free sphingoid base that functions as an endogenous antimicrobial agent. ACER1 is highly expressed in epidermis and catalyzes the hydrolysis of very long chain ceramides to generate sphingosine (Houben et al., 2006 [PubMed 16477081]; Sun et al., 2008 [PubMed 17713573]).[supplied by OMIM, Jul 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...