Synapsin III (SYN3) (NM_133633) Human Untagged Clone

CAT#: SC305975

SYN3 (untagged)-Human synapsin III (SYN3), transcript variant IIIc



  "NM_133633" in other vectors (4)

CNY 7,130.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SYN3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_133633, the custom clone sequence may differ by one or more nucleotides
ATGAATTTCCTCCGGCGACGTCTCTCTGACAGCAGCTTCATGGCCAACCTGCCTAATGGC
TATATGACGGACCTGCAACGCCCAGATAGCTCCACCAGCTCACCTGCTTCCCCCGCCATG
GAGAGGAGGCACCCCCAGCCCCTGGCTGCCTCCTTCTCCTCTCCAGGATCCAGCCTTTTT
AGCTCCCTCTCCAGTGCCATGAAGCAGGCCCCTCAGGCCACCTCAGGACTGATGGAGCCT
CCAGGTCCCTCCACGCCCATTGTTCAAAGACCCAGGATCCTGTTGGTGATCGATGATGCC
CATACAGACTGGTCGAAGTATTTCCATGGGAAGAAGGTGAATGGAGAGATTGAGATCCGA
GTGGAGCAGGCTGAATTCTCAGAGTTGAACCTAGCTGCCTATGTGACCGGGGGCTGCATG
GTGGACATGCAGGTCGTGAGAAATGGGACCAAAGTGGTGAGCAGATCCTTCAAGCCAGAC
TTCATCCTGGTCCGCCAGCATGCCTACAGCATGGCCCTGGGGGAAGACTACCGCAGCCTG
GTCATCGGCCTGCAGTATGGAGGGCTGCCTGCTGTCAACTCTCTCTACTCCGTCTACAAC
TTCTGCAGCAAGCCCTGGGTGTTCTCTCAGCTCATTAAGATCTTCCATTCCCTGGGTCCT
GAGAAGTTCCCGCTTGTGGAGCAAACATTTTTCCCCAACCATAAGCCAATGGTCACAGCC
CCACACTTCCCGGTGGTAGTCAAGCTGGGACATGCCCACGCTGGAATGGGAAAGATCAAA
GTGGAAAACCAGCTTGACTTCCAGGACATCACCAGCGTGGTCGCCATGGCCAAAACCTAC
GCCACCACCGAGGCCTTCATCGACTCCAAGTACGACATCCGCATCCAGAAAATTGGATCC
AACTACAAGGCTTACATGAGAACCTCCATCTCTGGGAACTGGAAGGCCAACACAGGCTCT
GCCATGCTGGAGCAGGTGGCCATGACAGAGAGGTACAGGCTGTGGGTGGACAGCTGCTCG
GAAATGTTTGGCGGCCTGGACATCTGTGCCGTCAAGGCTGTCCACAGCAAGGATGGCAGA
GATTACATCATCGAGGTAATGGACAGCTCAATGCCGCTGATTGGAGAGCATGTGGAAGAG
GACAGACAGCTGATGGCCGACCTTGTTGTCTCCAAAATGAGCCAGCTCCCGATGCCAGGA
GGCACAGCGCCCTCCCCCCTCAGACCTTGGGCTCCACAGATTAAATCAGCGAAATCCCCA
GGGCAAGCCCAGCTGGGGCCTCAGCTAGGCCAGCCCCAGCCACGCCCACCTCCGCAAGCA
AATCTCAGTCCCTGA
Restriction Sites Please inquire     
ACCN NM_133633
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133633.1, NP_598344.1
RefSeq Size 2626 bp
RefSeq ORF 1335 bp
Locus ID 8224
UniProt ID O14994
Protein Families Secreted Protein
Gene Summary This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (IIIc) lacks exon 12, which results in a frameshift and early stop codon compared to variant IIIa. The encoded isoform (IIIc) lacks domains J and E, as compared to the full-length isoform IIIa.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...