HS6ST2 (NM_147175) Human Untagged Clone
CAT#: SC306301
HS6ST2 (untagged)-Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S
CNY 6,768.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MRXSPM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_147175, the custom clone sequence may differ by one or more nucleotides
ATGGCACTGCCTGCGTGTGCAGTCCGGGAGTTCGAGCCGCCGCGGCAACCGGAGCGAGGAGCGCCCGTCC GCACCACCTGTCCCCGCCGGCATTCCAGAGTAGAGGCCGAATTGGCAGCGAGCCGGCCCGGGTCGGTCGC CGCCTCAGTTCGCGCGGGCCCTCCTAGGGGTGTGTCTCACGGATTCCACACCCGGCCGCTCCTGGACAAG CCCCGAAAGGCGTCTTCTTCCCTGGCGGGAGCCGCGTGCGCCCCGCTTTTCGCGCTGCTGTCCCGGGGCC GCCGCAGGCGGATGCACGTCCTCAGGCGACGCTGGGACCTGGGCTCCCTCTGCCGGGCCCTGCTCACTCG GGGCCTGGCCGCCCTGGGCCACTCGCTGAAGCACGTGCTCGGTGCGATCTTCTCCAAGATTTTCGGCCCC ATGGCCAGCGTCGGGAACATGGATGAGAAATCCAACAAGCTGCTGCTAGCTTTGGTGATGCTCTTCCTAT TTGCCGTGATCGTCCTCCAATACGTGTGCCCCGGCACAGAATGCCAGCTCCTCCGCCTGCAGGCGTTCAG CTCCCCGGTGCCGGACCCGTACCGCTCGGAGGATGAGAGCTCCGCCAGGTTCGTGCCCCGCTACAATTTC ACCCGCGGCGACCTCCTGCGCAAGGTAGACTTCGACATCAAGGGCGATGACCTGATCGTGTTCCTGCACA TCCAGAAGACCGGGGGCACCACTTTCGGCCGCCACTTGGTGCGTAACATCCAGCTGGAGCAGCCGTGCGA GTGCCGCGTGGGTCAGAAGAAATGCACTTGCCACCGGCCGGGTAAGCGGGAAACCTGGCTCTTCTCCAGG TTCTCCACGGGCTGGAGCTGCGGGTTGCACGCCGACTGGACCGAGCTCACCAGCTGTGTGCCCTCCGTGG TGGACGGCAAGCGCGACGCCAGGCTGAGACCGTCCAGGAACTTCCACTACATCACCATCCTCCGAGACCC AGTGTCCCGGTACTTGAGTGAGTGGAGGCATGTCCAGAGAGGGGCAACATGGAAAGCATCCCTGCATGTC TGCGATGGAAGGCCTCCAACCTCCGAAGAGCTGCCCAGCTGCTACACTGGCGATGACTGGTCTGGCTGCC CCCTCAAAGAGTTTATGGACTGTCCCTACAATCTAGCCAACAACCGCCAGGTGCGCATGCTCTCCGACCT GACCCTGGTAGGCTGCTACAACCTCTCTGTCATGCCTGAAAAGCAAAGAAACAAGGTCCTTCTGGAAAGT GCCAAGTCAAATCTGAAGCACATGGCGTTCTTCGGCCTCACTGAGTTTCAGCGGAAGACCCAATATCTGT TTGAGAAAACCTTCAACATGAACTTTATTTCGCCATTTACCCAGTATAATACCACTAGGGCCTCTAGTGT AGAGATCAATGAGGAAATTCAAAAGCGTATTGAGGGACTGAATTTTCTGGATATGGAGTTGTACAGCTAT GCCAAAGACCTTTTTTTGCAGAGGTATCAGTTTATGAGGCAGAAAGAGCATCAGGAGGCCAGGCGAAAGC GTCAGGAACAACGCAAATTTCTGAAGGGAAGGCTCCTTCAGACCCATTTCCAGAGCCAGGGTCAGGGCCA GAGCCAGAATCCGAATCAGAATCAGAGTCAGAACCCAAATCCGAATGCCAATCAGAACCTGACTCAGAAT CTGATGCAGAATCTGACTCAGAGTTTGAGCCAGAAGGAGAACCGGGAAAGCCCGAAGCAGAACTCAGGCA AGGAGCAGAATGATAACACCAGCAATGGCACCAACGACTACATAGGCAGTGTAGAGAAATGGCGTTAA |
Restriction Sites | Please inquire |
ACCN | NM_147175 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_147175.2, NP_671704.2 |
RefSeq Size | 4441 bp |
RefSeq ORF | 1818 bp |
Locus ID | 90161 |
UniProt ID | Q96MM7 |
Protein Families | Transmembrane |
Protein Pathways | Heparan sulfate biosynthesis |
Gene Summary | Heparan sulfate proteoglycans are ubiquitous components of the cell surface, extracellular matrix, and basement membranes, and interact with various ligands to influence cell growth, differentiation, adhesion, and migration. This gene encodes a member of the heparan sulfate (HS) sulfotransferase gene family, which catalyze the transfer of sulfate to HS. Different family members and isoforms are thought to synthesize heparan sulfates with tissue-specific structures and functions. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (S) lacks an alternate in-frame segment, compared to variant L, resulting in a shorter protein (isoform S). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221640 | HS6ST2 (Myc-DDK-tagged)-Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S |
CNY 6,752.00 |
|
RC221640L1 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S, Myc-DDK-tagged |
CNY 9,152.00 |
|
RC221640L2 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S, mGFP tagged |
CNY 5,890.00 |
|
RC221640L3 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221640L4 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S, mGFP tagged |
CNY 5,890.00 |
|
RG221640 | HS6ST2 (tGFP-tagged) - Human heparan sulfate 6-O-sulfotransferase 2 (HS6ST2), transcript variant S |
CNY 8,352.00 |