PITX2 (NM_153426) Human Untagged Clone

CAT#: SC306601

PITX2 (untagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 2



  "NM_153426" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
PITX2 mouse monoclonal antibody,clone OTI1H10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_153426 edited
ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGGCGTGCAGCCGGCG
GCCGTTGAATGTCTCTTCTCCAAAGACTCCGAAATCAAAAAGGTCGAGTTCACGGACTCT
CCTGAGAGCCGAAAAGAGGCAGCCAGCAGCAAGTTCTTCCCGCGGCAGCATCCTGGCGCC
AATGAGAAAGATAAAAGCCAGCAGGGGAAGAATGAGGACGTGGGCGCCGAGGACCCGTCT
AAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTTACCAGCCAGCAGCTCCAGGAGCTG
GAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGCGAAGAAATCGCTGTG
TGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCCAAATGG
AGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTC
AATGGGCTCATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCC
GCCAAGGGCCTTACATCCGCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATG
AACGTCAACCCCCTGTCATCACAGAGCATGTTTTCCCCACCCAACTCTATCTCGTCCATG
AGCATGTCGTCCAGCATGGTGCCCTCAGCAGTGACAGGCGTCCCGGGCTCCAGTCTCAAC
AGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTGAATTCCGCGGTGCCGACGCCT
GCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACGTGTAACTCGAGC
CTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAG
AACCCGGCCTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA
Restriction Sites Please inquire     
ACCN NM_153426
Insert Size 950 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153426.1, NP_700475.1
RefSeq Size 2250 bp
RefSeq ORF 954 bp
Locus ID 5308
UniProt ID Q99697
Protein Families Transcription Factors
Protein Pathways TGF-beta signaling pathway
Gene Summary This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also known as ARP1b, encodes the predominant isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...