PITX2 (NM_153427) Human Untagged Clone
CAT#: SC306602
PITX2 (untagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 1
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306602 representing NM_153427.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGAGAAAGATAAAAGCCAGCAGGGG AAGAATGAGGACGTGGGCGCCGAGGACCCGTCTAAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTT ACCAGCCAGCAGCTCCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGC GAAGAAATCGCTGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCC AAATGGAGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTCAAT GGGCTCATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCCGCCAAGGGCCTT ACATCCGCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCA CAGAGCATGTTTTCCCCACCCAACTCTATCTCGTCCATGAGCATGTCGTCCAGCATGGTGCCCTCAGCA GTGACAGGCGTCCCGGGCTCCAGTCTCAACAGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTG AATTCCGCGGTGCCGACGCCTGCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACG TGTAACTCGAGCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTG CAGAACCCGGCCTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_153427 |
Insert Size | 816 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153427.2 |
RefSeq Size | 3110 bp |
RefSeq ORF | 816 bp |
Locus ID | 5308 |
UniProt ID | Q99697 |
Protein Families | Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
MW | 30.3 kDa |
Gene Summary | This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also known as ARP1a, lacks an in-frame exon in the 5' region, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b. Variants 1 and 6 encode the same isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210612 | PITX2 (Myc-DDK-tagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 1 |
CNY 2,400.00 |
|
RC210612L1 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210612L2 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC210612L3 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210612L4 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG210612 | PITX2 (tGFP-tagged) - Human paired-like homeodomain 2 (PITX2), transcript variant 1 |
CNY 4,000.00 |