PANK2 (NM_153640) Human Untagged Clone
CAT#: SC306633
PANK2 (untagged)-Human pantothenate kinase 2 (PANK2), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf48; HARP; HSS; NBIA1; PKAN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306633 representing NM_153640.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTGCTTTTATTCAAATGGGCAGAGATAAAAACTTCTCGAGTCTCCACACTGTCTTTTGTGCCACT GGAGGTGGAGCGTACAAATTTGAGCAGGATTTTCTCACAATAGGTGATCTTCAGCTTTGCAAACTGGAT GAACTAGATTGCTTGATCAAAGGAATTTTATACATTGACTCAGTCGGATTCAATGGACGGTCACAGTGC TATTACTTTGAAAACCCTGCTGATTCTGAAAAGTGTCAGAAGTTACCATTTGATTTGAAAAATCCGTAT CCTCTGCTTCTGGTGAACATTGGCTCAGGGGTTAGCATCTTAGCAGTATATTCCAAAGATAATTACAAA CGGGTCACAGGTACTAGTCTTGGAGGAGGAACTTTTTTTGGTCTCTGCTGTCTTCTTACTGGCTGTACC ACTTTTGAAGAAGCTCTTGAAATGGCATCTCGTGGAGATAGCACCAAAGTGGATAAACTAGTACGAGAT ATTTATGGAGGGGACTATGAGAGGTTTGGACTGCCAGGCTGGGCTGTGGCTTCAAGCTTTGGAAACATG ATGAGCAAGGAGAAGCGAGAGGCTGTCAGTAAAGAGGACCTGGCCAGAGCGACTTTGATCACCATCACC AACAACATTGGCTCAATAGCAAGAATGTGTGCCCTTAATGAAAACATTAACCAGGTGGTATTTGTTGGA AATTTCTTGAGAATTAATACGATCGCCATGCGGCTTTTGGCATATGCTTTGGATTATTGGTCCAAGGGG CAGTTGAAAGCACTTTTTTCGGAACACGAGGGTTATTTTGGAGCTGTTGGAGCACTCCTTGAGCTGTTG AAGATCCCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_153640 |
Insert Size | 840 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153640.3 |
RefSeq Size | 7817 bp |
RefSeq ORF | 840 bp |
Locus ID | 80025 |
UniProt ID | Q9BZ23 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis |
MW | 30.8 kDa |
Gene Summary | This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an alternate first exon, and uses a downstream translation initiation site, compared to variant 1. The resulting protein (isoform 2) lacks an N-terminal segment compared to isoform 1, resulting in a shorter protein that shares identity through the C-terminus. Isoform 2 is not expressed in mitochondria. Variants 2, 3 and 7 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215745 | PANK2 (Myc-DDK-tagged)-Human pantothenate kinase 2 (PANK2), transcript variant 2 |
CNY 2,400.00 |
|
RC215745L3 | Lenti ORF clone of Human pantothenate kinase 2 (PANK2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215745L4 | Lenti ORF clone of Human pantothenate kinase 2 (PANK2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215745 | PANK2 (tGFP-tagged) - Human pantothenate kinase 2 (PANK2), transcript variant 2 |
CNY 4,370.00 |