FBXO16 (NM_172366) Human Untagged Clone

CAT#: SC306761

FBXO16 (untagged)-Human F-box protein 16 (FBXO16)



  "NM_172366" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FBXO16 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBX16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306761 representing NM_172366.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGCATTTGCACCTCCAAAAAACACAGATGGTCCCAAAATGCAGACAAAGATGAGCACCTGGACA
CCCCTAAACCATCAGCTATTGAATGACCGGGTATTTGAAGAAAGAAGAGCCCTGCTTGGCAAATGGTTT
GACAAATGGACAGACTCTCAAAGAAGAAGAATCCTCACAGGCCTGTTGGAGCGCTGCTCGCTGTCCCAG
CAAAAGTTCTGCTGTCGAAAGCTTCAAGAGAAAATTCCAGCAGAAGCCCTGGACTTTACAACCAAGCTT
CCAAGGGTGTTATCTTTATACATCTTTTCTTTCCTGGACCCTCGGAGCCTTTGTCGTTGTGCACAGGTG
TGCTGGCATTGGAAGAACCTTGCTGAGCTGGACCAGCTCTGGATGCTGAAATGTTTACGGTTTAACTGG
TACATCAATTTCTCTCCAACTCCCTTTGAGCAGGGGATCTGGAAGAAGCACTATATTCAAATGGTGAAA
GAACTTCATATTACCAAGCCTAAGACACCCCCAAAGGATGGATTTGTAATCGCTGACGTTCAACTAGTT
ACAAGCAATTCTCCAGAGGAAAAACAGTCCCCTTTATCAGCTTTTCGGTCCTCTTCCTCTTTAAGAAAG
AAGAATAACTCAGGGGAGAAAGCACTTCCACCCTGGCGATCTTCTGATAAGCACCCAACAGATATCATT
CGTTTTAATTACCTAGACAACCGTGACCCCATGGAGACTGTCCAGCAAGGAAGAAGAAAAAGAAACCAA
ATGACCCCAGACTTCAGCCGACAGTCACATGATAAGAAAAATAAATTGCAGGACAGAACTAGGCTAAGA
AAAGCACAATCAATGATGTCGAGGAGAAATCCCTTCCCACTATGTCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_172366
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172366.3
RefSeq Size 1362 bp
RefSeq ORF 879 bp
Locus ID 157574
UniProt ID Q8IX29
Protein Families Druggable Genome
MW 34.6 kDa
Gene Summary This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...