DNMT3A (NM_175630) Human Untagged Clone
CAT#: SC307008
DNMT3A (untagged)-Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DNMT3A2; HESJAS; M.HsaIIIA; TBRS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_175630 edited
GACGCGGCGCCGCGGCACCAGGGCGCGCAGCCGGGCCGGCCCGACCCCACCGGCCATACG GTGGAGCCATCGAAGCCCCCACCCACAGGCTGACAGAGGCACCGTTCACCAGAGGGCTCA ACACCGGGATCTATGTTTAAGTTTTAACTCTCGCCTCCAAAGACCACGATAATTCCTTCC CCAAAGCCCAGCAGCCCCCCAGCCCCGCGCAGCCCCAGCCTGCCTCCCGGCGCCCAGATG CCCGCCATGCCCTCCAGCGGCCCCGGGGACACCAGCAGCTCTGCTGCGGAGCGGGAGGAG GACCGAAAGGACGGAGAGGAGCAGGAGGAGCCGCGTGGCAAGGAGGAGCGCCAAGAGCCC AGCACCACGGCACGGAAGGTGGGGCGGCCTGGGAGGAAGCGCAAGCACCCCCCGGTGGAA AGCGGTGACACGCCAAAGGACCCTGCGGTGATCTCCAAGTCCCCATCCATGGCCCAGGAC TCAGGCGCCTCAGAGCTATTACCCAATGGGGACTTGGAGAAGCGGAGTGAGCCCCAGCCA GAGGAGGGGAGCCCTGCTGGGGGGCAGAAGGGCGGGGCCCCAGCAGAGGGAGAGGGTGCA GCTGAGACCCTGCCTGAAGCCTCAAGAGCAGTGGAAAATGGCTGCTGCACCCCCAAGGAG GGCCGAGGAGCCCCTGCAGAAGCGGGTGAGTCCTCAGCACCAGGGGCAGCCTCTTCTGGG CCCACCAGCATACCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_175630 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175630.1, NP_783329.1 |
RefSeq Size | 1808 bp |
RefSeq ORF | 501 bp |
Locus ID | 1788 |
UniProt ID | Q9Y6K1 |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Metabolic pathways |
Gene Summary | CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. [provided by RefSeq, Mar 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221832 | DNMT3A (Myc-DDK-tagged)-Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4 |
CNY 3,990.00 |
|
RC221832L3 | Lenti-ORF clone of DNMT3A (Myc-DDK-tagged)-Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4 |
CNY 5,890.00 |
|
RC221832L4 | Lenti-ORF clone of DNMT3A (mGFP-tagged)-Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4 |
CNY 5,890.00 |
|
RG221832 | DNMT3A (tGFP-tagged) - Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4 |
CNY 4,370.00 |