DNMT3A (NM_175630) Human Untagged Clone

CAT#: SC307008

DNMT3A (untagged)-Human DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 4



  "NM_175630" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse Monoclonal DNMT3A Antibody (64B1446)
    • 100 ug

CNY 6,188.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DNMT3A2; HESJAS; M.HsaIIIA; TBRS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_175630 edited
GACGCGGCGCCGCGGCACCAGGGCGCGCAGCCGGGCCGGCCCGACCCCACCGGCCATACG
GTGGAGCCATCGAAGCCCCCACCCACAGGCTGACAGAGGCACCGTTCACCAGAGGGCTCA
ACACCGGGATCTATGTTTAAGTTTTAACTCTCGCCTCCAAAGACCACGATAATTCCTTCC
CCAAAGCCCAGCAGCCCCCCAGCCCCGCGCAGCCCCAGCCTGCCTCCCGGCGCCCAGATG
CCCGCCATGCCCTCCAGCGGCCCCGGGGACACCAGCAGCTCTGCTGCGGAGCGGGAGGAG
GACCGAAAGGACGGAGAGGAGCAGGAGGAGCCGCGTGGCAAGGAGGAGCGCCAAGAGCCC
AGCACCACGGCACGGAAGGTGGGGCGGCCTGGGAGGAAGCGCAAGCACCCCCCGGTGGAA
AGCGGTGACACGCCAAAGGACCCTGCGGTGATCTCCAAGTCCCCATCCATGGCCCAGGAC
TCAGGCGCCTCAGAGCTATTACCCAATGGGGACTTGGAGAAGCGGAGTGAGCCCCAGCCA
GAGGAGGGGAGCCCTGCTGGGGGGCAGAAGGGCGGGGCCCCAGCAGAGGGAGAGGGTGCA
GCTGAGACCCTGCCTGAAGCCTCAAGAGCAGTGGAAAATGGCTGCTGCACCCCCAAGGAG
GGCCGAGGAGCCCCTGCAGAAGCGGGTGAGTCCTCAGCACCAGGGGCAGCCTCTTCTGGG
CCCACCAGCATACCCTGA
Restriction Sites Please inquire     
ACCN NM_175630
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175630.1, NP_783329.1
RefSeq Size 1808 bp
RefSeq ORF 501 bp
Locus ID 1788
UniProt ID Q9Y6K1
Protein Families Druggable Genome
Protein Pathways Cysteine and methionine metabolism, Metabolic pathways
Gene Summary CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. [provided by RefSeq, Mar 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...