United States
Germany
Japan
United Kingdom
China
Junctophilin 2 (JPH2) (NM_175913) Human Untagged Clone
CAT＃: SC307053
JPH2 (untagged)-Human junctophilin 2 (JPH2), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CMH17; JP-2; JP2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_175913, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGGGGCCGCTTCGACTTTGATGATGGAGGGGCGTACTGCGGGGGCTGGGAGGGG GGAAAGGCCCATGGGCATGGACTGTGCACAGGCCCCAAGGGCCAGGGCGAATACTCTGGC TCCTGGAACTTTGGCTTTGAGGTGGCAGGTGTCTACACCTGGCCCAGCGGAAACACCTTT GAGGGATACTGGAGCCAGGGCAAACGGCATGGGCTGGGCATAGAGACCAAGGGGCGCTGG CTCTACAAGGGCGAGTGGACACATGGCTTCAAGGGACGCTACGGAATCCGGCAGAGCTCA AGCAGCGGTGCCAAGTATGAGGGCACCTGGAACAATGGCCTGCAAGACGGCTATGGCACC GAGACCTATGCTGATGGAGGGATGTGTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_175913 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_175913.3, NP_787109.2 |
| RefSeq Size | 2408 bp |
| RefSeq ORF | 390 bp |
| Locus ID | 57158 |
| UniProt ID | Q9BR39 |
| Protein Families | Transmembrane |
| Gene Summary | Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217869 | JPH2 (Myc-DDK-tagged)-Human junctophilin 2 (JPH2), transcript variant 2 |
CNY 1,320.00 |
|
| RC217869L3 | Lenti-ORF clone of JPH2 (Myc-DDK-tagged)-Human junctophilin 2 (JPH2), transcript variant 2 |
CNY 5,890.00 |
|
| RC217869L4 | Lenti-ORF clone of JPH2 (mGFP-tagged)-Human junctophilin 2 (JPH2), transcript variant 2 |
CNY 5,890.00 |
|
| RG217869 | JPH2 (tGFP-tagged) - Human junctophilin 2 (JPH2), transcript variant 2 |
CNY 2,920.00 |
其它Junctophilin 2产品
