NICE2 (S100A7A) (NM_176823) Human Untagged Clone
CAT#: SC307072
S100A7A (untagged)-Human S100 calcium binding protein A7A (S100A7A)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NICE-2; NICE2; S100A7f; S100A7L1; S100A15 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_176823, the custom clone sequence may differ by one or more nucleotides
ATGAGCAACACTCAAGCTGAGAGGTCCATAATAGGCATGATCGACATGTTTCACAAATACACCGGACGTG ATGGCAAGATTGAGAAGCCAAGCCTGCTGACGATGATGAAGGAGAACTTCCCCAATTTCCTCAGTGCCTG TGACAAAAAGGGCATACATTACCTCGCCACTGTCTTTGAGAAAAAGGACAAGAATGAGGATAAGAAGATT GATTTTTCTGAGTTTCTGTCCTTGCTGGGAGACATAGCCGCAGACTACCACAAGCAGAGCCATGGAGCGG CGCCCTGTTCTGGGGGAAGCCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_176823 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_176823.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_176823.2, NP_789793.1 |
RefSeq Size | 4351 bp |
RefSeq ORF | 306 bp |
Locus ID | 338324 |
UniProt ID | Q86SG5 |
Gene Summary | May be involved in epidermal differentiation and inflammation and might therefore be important for the pathogenesis of psoriasis and other diseases.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221177 | S100A7A (Myc-DDK-tagged)-Human S100 calcium binding protein A7A (S100A7A) |
CNY 1,200.00 |
|
RC221177L1 | Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC221177L2 | Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), mGFP tagged |
CNY 5,890.00 |
|
RC221177L3 | Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221177L4 | Lenti ORF clone of Human S100 calcium binding protein A7A (S100A7A), mGFP tagged |
CNY 5,890.00 |
|
RG221177 | S100A7A (tGFP-tagged) - Human S100 calcium binding protein A7A (S100A7A) |
CNY 4,370.00 |