PTF1A (NM_178161) Human Untagged Clone

CAT#: SC307134

PTF1A (untagged)-Human pancreas specific transcription factor, 1a (PTF1A)



  "NM_178161" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
PTF1A mouse monoclonal antibody,clone OTI1H6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHa29; p48; PACA; PAGEN2; PTF1-p48
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_178161 edited
ATGGACGCGGTGTTGCTGGAGCACTTCCCCGGGGGCCTAGACGCCTTTCCTTCTTCGTAC
TTCGACGAGGACGACTTCTTCACCGACCAGTCTTCACGGGACCCCCTGGAGGACGGCGAT
GAGCTGCTGGCGGACGAGCAGGCCGAGGTGGAGTTCCTTAGCCACCAGCTCCACGAGTAC
TGCTACCGCGACGGGGCGTGCCTGCTGCTGCAGCCCGCGCCCCCGGCCGCCCCGCTAGCG
CTCGCCCCGCCGTCCTCGGGGGGCCTCGGTGAGCCAGACGACGGCGGCGGCGGCGGCTAC
TGCTGCGAGACGGGGGCGCCCCCAGGCGGCTTCCCCTACTCGCCCGGCTCGCCGCCCTCG
TGCCTGGCCTACCCGTGCGCCGGGGCGGCAGTACTGTCTCCCGGGGCGCGGCTGCGCGGC
CTGAGCGGAGCGGCGGCTGCGGCGGCGCGGCGCCGGCGGCGGGTGCGCTCCGAGGCGGAG
CTGCAGCAGCTGCGGCAGGCGGCCAACGTGCGCGAGCGGCGGCGCATGCAGTCCATCAAC
GACGCCTTCGAGGGGCTGCGCTCGCACATCCCCACGCTGCCCTACGAGAAGCGCCTCTCC
AAGGTGGACACGCTGCGCCTGGCCATCGGCTACATCAACTTCCTCAGCGAGCTCGTGCAG
GCCGACCTGCCCTTGCGCGGCGGTGGCGCGGGCGGCTGCGGGGGGCCGGGCGGCGGCGGG
CGCCTGGGCGGGGACAGCCCGGGCAGCCAGGCCCAGAAGGTCATCATCTGCCATCGGGGC
ACCCGGTCCCCCTCCCCCAGCGACCCTGATTATGGCCTCCCTCCCCTAGCAGGACACTCT
CTCTCATGGACTGATGAAAAACAACTCAAGGAACAAAATATTATCCGAACAGCCAAAGTC
TGGACCCCAGAGGACCCCAGAAAACTCAACAGCAAATCTTCCTTCAACAACATAGAAAAC
GAACCACCATTTGAGTTTGTGTCCTGA
Restriction Sites Please inquire     
ACCN NM_178161
Insert Size 1000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178161.1, NP_835455.1
RefSeq Size 987 bp
RefSeq ORF 987 bp
Locus ID 256297
UniProt ID Q7RTS3
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS
Gene Summary This gene encodes a protein that is a component of the pancreas transcription factor 1 complex (PTF1) and is known to have a role in mammalian pancreatic development. The protein plays a role in determining whether cells allocated to the pancreatic buds continue towards pancreatic organogenesis or revert back to duodenal fates. The protein is thought to be involved in the maintenance of exocrine pancreas-specific gene expression including elastase 1 and amylase. Mutations in this gene cause cerebellar agenesis and loss of expression is seen in ductal type pancreas cancers. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...