United States
Germany
Japan
United Kingdom
China
Tuberoinfundibular peptide (PTH2) (NM_178449) Human Untagged Clone
CAT＃: SC307181
PTH2 (untagged)-Human parathyroid hormone 2 (PTH2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TIP39 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_178449 edited
CCGGGATGCAGCCCTACTGAGCCCCTTTCTGGTTCTCCACAGGTGATGGAGACCCGCCAG GTGTCCAGGAGCCCTCGGGTTCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGCCC TGGGGCGTCCGCACTGCCTCGGGAGTCGCCCTGCCCCCGGTCGGGGTCCTCAGCCTCCGC CCCCCAGGACGGGCCTGGGCGGATCCCGCCACCCCCAGGCCGCGGAGGAGCCTGGCGCTG GCGGACGACGCGGCCTTCCGGGAGCGCGCGCGGTTGCTGGCCGCCCTCGAGCGCCGCCAC TGGCTGAACTCGTACATGCACAAGCTGCTGGTGTTGGATGCGCCCTGAGCGCGCTGCCCG TCCCCATCTTAATAAAGACCATGCCCTGCGCTC |
| Restriction Sites | Please inquire |
| ACCN | NM_178449 |
| Insert Size | 400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178449.2, NP_848544.1 |
| RefSeq Size | 459 bp |
| RefSeq ORF | 303 bp |
| Locus ID | 113091 |
| UniProt ID | Q96A98 |
| Protein Families | Secreted Protein, Transmembrane |
| Gene Summary | This gene encodes the precursor of a peptide hormone that shares sequence similarity with the parathyroid hormone. This gene is expressed in various regions of the brain where it plays a role in the release of pituitary hormones, anxiety and nociception. The encoded precursor protein is proteolytically processed to generate the biologically active neuropeptide. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210906 | PTH2 (Myc-DDK-tagged)-Human parathyroid hormone 2 (PTH2) |
CNY 1,200.00 |
|
| RC210906L1 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC210906L2 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), mGFP tagged |
CNY 5,890.00 |
|
| RC210906L3 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210906L4 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), mGFP tagged |
CNY 5,890.00 |
|
| RG210906 | PTH2 (tGFP-tagged) - Human parathyroid hormone 2 (PTH2) |
CNY 2,800.00 |
其它Tuberoinfundibular peptide产品
