NDUFB6 (NM_182739) Human Untagged Clone
CAT#: SC307500
NDUFB6 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B17; CI |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_182739, the custom clone sequence may differ by one or more nucleotides
ATGACGGGGTACACTCCGGATGAGAAACTGCGGCTGCAGCAGCTGCGAGAGCTGAGAAGG CGATGGCTGAAGGACCAGGAGCTGAGCCCTCGGGAGCCGGTGCTGCCCCCACAGAAGATG GGGCCTATGGAGAAATTCTGGAATAAATTTTTGGAGAATAAATCCCCTTGGAGGAAAATG GTCCATGGGGTATACAAAAAGAGTATCTTTGTTTTCACTCATGTACTTGTACCTGTCTGG ATTATTCATTATTACATGAAGTATCATGTTTCTGGTGATACAATTCTGGAGACTGGAGAA GTAATTCCACCAATGAAAGAATTTCCTGATCAACATCATTAA |
Restriction Sites | Please inquire |
ACCN | NM_182739 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182739.1, NP_877416.1 |
RefSeq Size | 817 bp |
RefSeq ORF | 342 bp |
Locus ID | 4712 |
UniProt ID | O95139 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219791 | NDUFB6 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
RC219791L3 | Lenti-ORF clone of NDUFB6 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC219791L4 | Lenti-ORF clone of NDUFB6 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG219791 | NDUFB6 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |