C11orf17 (AKIP1) (NM_182901) Human Untagged Clone
CAT#: SC307530
AKIP1 (untagged)-Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BCA3; C11orf17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307530 representing NM_182901.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACAACTGTTTGGCGGCCGCAGCGCTGAATGGGGTGGACCGACGTTCCCTGCAGCGTTCAGCAAGG CTGGCTCTAGAAGTGCTGGAGAGGGCCAAGAGGAGGGCGGTGGACTGGCATGCCCTGGAGCGTCCCAAA GGCTGCATGGGGGTCCTTGCCCGGGAGGCGCCCCACCTAGAGAAACAGCCGGCAGCCGGCCCGCAGCGC GTTCTCCCGGGAGAGAGAGAAGAGAGACCCCCAACCCTTAGTGCTTCCTTCAGAACAATGGCTGAATTC ATGGACTATACTTCAAGTCAGTGTGGGAAATATTATTCATCTGTGCCAGAGGAAGGAGGGGCAACCCAT GTCTATCGTTATCACAGAGGCGAGTCGAAGCTGCACATGTGCTTGGACATAGGGAATGGTCAGAGAAAA GACAGAAAAAAGACATCCCTTGGTCCTGGAGGCAGCTATCAAATATCAGAGCATGCTCCAGAGGCATCC CAGCCTGCTGAGAACATCTCTAAGGACCTCTACATAGAAGTATATCCAGGGACCTATTCTGTCACTGTG GGCTCAAATGACTTAACCAAGAAGACTCATGTGGTAGCAGTTGATTCTGGACAAAGCGTGGACCTGGTC TTCCCTGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_182901 |
Insert Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182901.3 |
RefSeq Size | 1528 bp |
RefSeq ORF | 633 bp |
Locus ID | 56672 |
MW | 23.1 kDa |
Gene Summary | This gene encodes a nuclear protein that interacts with protein kinase A catalytic subunit, and regulates the effect of the cAMP-dependent protein kinase signaling pathway on the NF-kappa-B activation cascade. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205929 | AKIP1 (Myc-DDK-tagged)-Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1 |
CNY 2,400.00 |
|
RC205929L1 | Lenti ORF clone of Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205929L2 | Lenti ORF clone of Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC205929L3 | Lenti ORF clone of Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205929L4 | Lenti ORF clone of Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG205929 | AKIP1 (tGFP-tagged) - Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1 |
CNY 4,000.00 |
|
SC321130 | AKIP1 (untagged)-Human A kinase (PRKA) interacting protein 1 (AKIP1), transcript variant 1 |
CNY 2,400.00 |
其它C11orf17产品