MTH1 (NUDT1) (NM_198950) Human Untagged Clone
CAT#: SC307825
NUDT1 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3A
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MTH1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_198950, the custom clone sequence may differ by one or more nucleotides
ATGGGCGCCTCCAGGCTCTATACCCTGGTGCTGGTCCTGCAGCCTCAGCGAGTTCTCCTG GGCATGAAAAAGCGAGGCTTCGGGGCCGGCCGGTGGAATGGCTTTGGGGGCAAAGTGCAA GAAGGAGAGACCATCGAGGATGGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACA GTGGACGCCCTGCACAAGGTGGGCCAGATCGTGTTTGAGTTCGTGGGCGAGCCTGAGCTC ATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGACCCCCGTGGAGAGCGACGAA ATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGGCCCGACGAC AGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAG GGTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_198950 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198950.1, NP_945188.1 |
RefSeq Size | 740 bp |
RefSeq ORF | 471 bp |
Locus ID | 4521 |
UniProt ID | P36639 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A rare single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Dec 2018] Transcript Variant: This variant (3A) differs in the 5' UTR compared to variant 1. Variants 1, 2A, 3A, 4A, and 5 encode the same isoform (p18, also known as MTH1d). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212761 | NUDT1 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3A |
CNY 1,200.00 |
|
RC212761L3 | Lenti-ORF clone of NUDT1 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3A |
CNY 5,890.00 |
|
RC212761L4 | Lenti-ORF clone of NUDT1 (mGFP-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3A |
CNY 5,890.00 |
|
RG212761 | NUDT1 (tGFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3A |
CNY 4,370.00 |