United States
Germany
Japan
United Kingdom
China
Amino terminal enhancer of split (AES) (NM_198970) Human Untagged Clone
CAT＃: SC307836
AES (untagged)-Human amino-terminal enhancer of split (AES), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AES; AES-1; AES-2; ESP1; GRG; Grg-5; GRG5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307836 representing NM_198970.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGTTTCCACAAAGCAGGCATTCGGGCTCCTCGCACCTACCCCAGCAACTCAAATTCACCACCTCG GACTCCTGCGACCGCATCAAAGACGAATTTCAGCTACTGCAAGCTCAGTACCACAGCCTCAAGCTCGAA TGTGACAAGTTGGCCAGTGAGAAGTCAGAGATGCAGCGTCACTATGTGATGTACTACGAGATGTCCTAC GGCTTGAACATCGAGATGCACAAACAGGCTGAGATCGTCAAAAGGCTGAACGGGATTTGTGCCCAGGTC CTGCCCTACCTCTCCCAAGAGCACCAGCAGCAGGTCTTGGGAGCCATTGAGAGGGCCAAGCAGGTCACC GCTCCCGAGCTGAACTCTATCATCCGACAGCTCCAAGCCCACCAGCTGTCCCAGCTGCAGGCCCTGGCC CTGCCCTTGACCCCACTACCCGTGGGGCTGCAGCCGCCTTCGCTGCCGGCGGTCAGCGCAGGCACCGGC CTCCTCTCGCTGTCCGCGCTGGGTTCCCAGGCCCACCTCTCCAAGGAAGACAAGAACGGGCACGATGGT GACACCCACCAGGAGGATGATGGCGAGAAGTCGGATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_198970 |
| Insert Size | 591 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198970.1 |
| RefSeq Size | 1684 bp |
| RefSeq ORF | 591 bp |
| Locus ID | 166 |
| UniProt ID | Q08117 |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 21.8 kDa |
| Gene Summary | The protein encoded by this gene is similar in sequence to the amino terminus of Drosophila enhancer of split groucho, a protein involved in neurogenesis during embryonic development. The encoded protein, which belongs to the groucho/TLE family of proteins, can function as a homooligomer or as a heteroologimer with other family members to dominantly repress the expression of other family member genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (c) is shorter, has a distinct N-terminus, and lacks 1 aa in the C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213043 | AES (Myc-DDK-tagged)-Human amino-terminal enhancer of split (AES), transcript variant 3 |
CNY 2,400.00 |
|
| RC213043L3 | Lenti ORF clone of Human amino-terminal enhancer of split (AES), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213043L4 | Lenti ORF clone of Human amino-terminal enhancer of split (AES), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG213043 | AES (tGFP-tagged) - Human amino-terminal enhancer of split (AES), transcript variant 3 |
CNY 4,370.00 |
其它Amino terminal enhancer of split产品
