United States
Germany
Japan
United Kingdom
China
Osteocalcin (BGLAP) (NM_199173) Human Untagged Clone
CAT＃: SC307883
BGLAP (untagged)-Human bone gamma-carboxyglutamate (gla) protein (BGLAP)
CNY 1,200.00
CNY 3,990.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BGP; OC; OCN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_199173 edited
ACACCATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTG GCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCA AGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAG CCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGG ACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCC CGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCTCTCCAGGC ACCCTTCTTTCCT |
| Restriction Sites | Please inquire |
| ACCN | NM_199173 |
| Insert Size | 400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF of this clone is a perfect match to the reference, NM_199173.2 |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199173.2, NP_954642.1 |
| RefSeq Size | 498 bp |
| RefSeq ORF | 303 bp |
| Locus ID | 632 |
| UniProt ID | P02818 |
| Protein Families | ES Cell Differentiation/IPS, Secreted Protein |
| Gene Summary | This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. [provided by RefSeq, Jun 2015] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Molecular mechanisms of allosteric inhibition of brain glycogen phosphorylase by neurotoxic dithiocarbamate chemicals
,Mathieu, C;Bui, LC;Petit, E;Haddad, I;Agbulut, O;Vinh, J;Dupret, JM;Rodrigues Lima, F;,
J. Biol. Chem
,PubMed ID 27965358
[BGLAP]
|
|
Insights into Brain Glycogen Metabolism: The Structure of Human Brain Glycogen Phosphorylase
,Mathieu, C;Li de la Sierra-Gallay, I;Duval, R;Xu, X;Cocaign, A;Léger, T;Woffendin, G;Camadro, JM;Etchebest, C;Haouz, A;Dupret, JM;Rodrigues-Lima, F;,
J. Biol. Chem.
,PubMed ID 27402852
[BGLAP]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220555 | BGLAP (Myc-DDK-tagged)-Human bone gamma-carboxyglutamate (gla) protein (BGLAP) |
CNY 1,200.00 |
|
| RC220555L3 | Lenti ORF clone of Human bone gamma-carboxyglutamate (gla) protein (BGLAP), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220555L4 | Lenti ORF clone of Human bone gamma-carboxyglutamate (gla) protein (BGLAP), mGFP tagged |
CNY 5,890.00 |
|
| RG220555 | BGLAP (tGFP-tagged) - Human bone gamma-carboxyglutamate (gla) protein (BGLAP) |
CNY 4,370.00 |
其它Osteocalcin产品
