BPGM (NM_199186) Human Untagged Clone

CAT#: SC307893

BPGM (untagged)-Human 2,3-bisphosphoglycerate mutase (BPGM), transcript variant 2



  "NM_199186" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


BPGM rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DPGM; ECYT8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307893 representing NM_199186.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCAAGTACAAACTTATTATGTTAAGACATGGAGAGGGTGCTTGGAATAAGGAGAACCGTTTTTGT
AGCTGGGTGGATCAGAAACTCAACAGCGAAGGAATGGAGGAAGCTCGGAACTGTGGGAAGCAACTCAAA
GCGTTAAACTTTGAGTTTGATCTTGTATTCACATCTGTCCTTAATCGGTCCATTCACACAGCCTGGCTG
ATCCTGGAAGAGCTAGGCCAGGAATGGGTGCCTGTGGAAAGCTCCTGGCGTCTAAATGAGCGTCACTAT
GGGGCCTTGATCGGTCTCAACAGGGAGCAGATGGCTTTGAATCATGGTGAAGAACAAGTGAGGCTCTGG
AGAAGAAGCTACAATGTAACCCCGCCTCCCATTGAGGAGTCTCATCCTTACTACCAAGAAATCTACAAC
GACCGGAGGTATAAAGTATGCGATGTGCCCTTGGATCAACTGCCACGGTCGGAAAGCTTAAAGGATGTT
CTGGAGAGACTCCTTCCCTATTGGAATGAAAGGATTGCTCCCGAAGTATTACGTGGCAAAACCATTCTG
ATATCTGCTCATGGAAATAGCAGTAGGGCACTCCTAAAACACCTGGAAGGTATCTCAGATGAAGACATC
ATCAACATTACTCTTCCTACTGGAGTCCCCATTCTTCTGGAATTGGATGAAAACCTGCGTGCTGTTGGG
CCTCATCAGTTCCTGGGTGACCAAGAGGCGATCCAAGCAGCCATTAAGAAAGTAGAAGATCAAGGAAAA
GTGAAACAAGCTAAAAAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199186
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_199186.2
RefSeq Size 2121 bp
RefSeq ORF 780 bp
Locus ID 669
UniProt ID P07738
Protein Families Druggable Genome
Protein Pathways Glycolysis / Gluconeogenesis, Metabolic pathways
MW 30 kDa
Gene Summary 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) represents the longer transcript. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...