KCNRG (NM_199464) Human Untagged Clone
CAT#: SC307987
KCNRG (untagged)-Human potassium channel regulator (KCNRG), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DLTET |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307987 representing NM_199464.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTAGTCAGGAACTGGTCACTTTGAATGTGGGAGGGAAGATATTCACGACAAGGTTTTCTACGATA AAGCAGTTTCCTGCTTCTCGTTTGGCACGCATGTTAGATGGCAGAGACCAAGAATTCAAGATGGTTGGT GGCCAGATTTTTGTAGACAGAGATGGTGATTTGTTTAGTTTCATCTTAGATTTTTTGAGAACTCACCAG CTTTTATTACCCACTGAATTTTCAGACTATCTTAGGCTTCAGAGAGAGGCTCTTTTCTATGAACTTCGT TCTCTAGTTGATCTCTTAAACCCATACCTGCTACAGCCAAGACCTGCTCTTGTGGAGGTACATTTCCTA AGCCGGAACACTCAAGCTTTTTTCAGGGTGTTTGGCTCTTGCAGCAAAACAATTGAGATGCTAACAGGG AGGATTACAGTGTTTACAGAACAACCTTCAGCGCCGACCTGGAATGGTAACTTTTTCCCTCCTCAGATG ACCTTACTTCCACTGCCTCCACAAAGACCTTCTTACCATGACCTGGTTTTCCAGTGTGGTTCTGACAGC ACTACTGATAACCAAACTGGAGTCAGGCTGGTATGCAATGGCGTGATCTCGGCTCACCACAACCTCCGC CTCTGGGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTATGTTTCTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_199464 |
Insert Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199464.2 |
RefSeq Size | 1639 bp |
RefSeq ORF | 690 bp |
Locus ID | 283518 |
UniProt ID | Q8N5I3 |
MW | 25.9 kDa |
Gene Summary | This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) contains an alternate exon which results in a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212086 | KCNRG (Myc-DDK-tagged)-Human potassium channel regulator (KCNRG), transcript variant 2 |
CNY 2,400.00 |
|
RC212086L1 | Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC212086L2 | Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC212086L3 | Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212086L4 | Lenti ORF clone of Human potassium channel regulator (KCNRG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212086 | KCNRG (tGFP-tagged) - Human potassium channel regulator (KCNRG), transcript variant 2 |
CNY 4,370.00 |