PVRL1 (NECTIN1) (NM_203286) Human Untagged Clone

CAT#: SC308098

PVRL1 (untagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3



  "NM_203286" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PVRL1 mouse monoclonal antibody, clone OTI6F8 (formerly 6F8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308098 representing NM_203286.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCGGATGGGGCTTGCGGGCGCCGCTGGACGCTGGTGGGGACTCGCTCTCGGCTTGACCGCATTC
TTCCTCCCAGGCGTCCACTCCCAGGTGGTCCAGGTGAACGACTCCATGTATGGCTTCATCGGCACAGAC
GTGGTTCTGCACTGCAGCTTTGCCAACCCGCTTCCCAGCGTGAAGATCACCCAGGTCACATGGCAGAAG
TCCACCAATGGCTCCAAGCAGAACGTGGCCATCTACAACCCATCCATGGGCGTGTCCGTGCTGGCTCCC
TACCGCGAGCGTGTGGAATTCCTGCGGCCCTCCTTCACCGATGGCACTATCCGCCTCTCCCGCCTGGAG
CTGGAGGATGAGGGTGTCTACATCTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTC
AATCTCACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAGAAG
GGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGTGGTATCC
TGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAACCCCAATGGCACAGTGACGGTC
ATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCACCAGCAGTCCTTGGCCTGCATCGTCAACTAC
CACATGGACCGCTTCAAGGAAAGCCTCACTCTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGG
TTTGATGGCAACTGGTACCTGCAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTAACCCCCCA
GCCACTGAGTACCACTGGACCACGCTAAATGGCTCTCTCCCCAAGGGTGTGGAGGCCCAGAACAGAACC
CTCTTCTTCAAGGGACCCATCAACTACAGCCTGGCAGGGACCTACATCTGTGAGGCCACCAACCCCATC
GGTACACGCTCAGGCCAGGTGGAGGTCAATATCACAGCTTTCTGTCAACTTATCTATCCGGGCAAAGGG
AGGACAAGAGCTAGGATGTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_203286
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_203286.1
RefSeq Size 1451 bp
RefSeq ORF 1059 bp
Locus ID 5818
UniProt ID Q15223
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Adherens junction, Cell adhesion molecules (CAMs)
MW 39.1 kDa
Gene Summary This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (3) uses an alternate exon for its 3' end, compared to variant 1, resulting in a protein (isoform 3; also known as isoform Gamma) with a shorter and distinct C-terminus, compared to isoform 1. In contrast to isoforms 1 and 2, isoform 3 may be a soluble protein since it is predicted to lack a transmembrane domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...