United States
Germany
Japan
United Kingdom
China
RNF90 (TRIM7) (NM_203294) Human Untagged Clone
CAT＃: SC308105
TRIM7 (untagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 5
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GNIP; RNF90 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_203294, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGGAGCAGGAGAAGGTGGGGGCAGAGTTCCAGGCACTGAGGGCTTTCCTGGTG GAGCAGGAGGGTCGGCTGCTAGGCCGCCTGGAGGAACTGTCCCGGGAGGTGGCACAGAAG CAGAATGAGAACCTGGCCCAGCTCGGGGTTGAGATCACCCAGCTGTCCAAGCTCAGCAGC CAGATCCAGGAGACAGCTCAAAAGCCTGACCTTGACTTTCTCCAGGAATTCAAAAGCACG CTGAGCAGGTGTAGCAATGTGCCTGGCCCCAAGCCAACCACAGTCTCTTCTGAGATGAAG AATAAAGTCTGGAATGTTTCTCTCAAGACCTTTGTCTTAAAAGGGATGCTGAAGAAGTTC AAAGAGGACCTTCGGGGAGAGCTGGAGAAAGAGGAGAAAGTGGAGCTCACCTTGGATCCC GACACGGCCAACCCGCGCCTCATCCTCTCTCTGGATCTTAAGGGCGTGCGCCTCGGCGAG CGGGCCCAGGACCTGCCCAACCACCCCTGCCGCTTCGACACCAACACCCGCGTCCTGGCG TCCTGCGGCTTCTCCTCGGGCCGGCATCACTGGGAGGTGGAGGTGGGCTCTAAGGACGGC TGGGCCTTTGGCGTGGCCCGCGAGAGCGTGCGCCGAAAGGGCCTGACGCCCTTCACTCCC GAGGAGGGCGTCTGGGCCCTGCAGCTCAACGGCGGCCAGTACTGGGCCGTGACCAGCCCC GAGCGGTCGCCCCTCAGCTGCGGGCACCTGTCGCGCGTGCGGGTGGCCCTGGACCTGGAG GTGGGAGCCGTGTCCTTCTACGCTGTGGAGGACATGCGCCACCTCTACACCTTCCGCGTC AACTTCCAGGAGCGCGTGTTCCCGCTTTTCTCTGTTTGCTCCACGGGCACCTACTTGCGA ATCTGGCCTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_203294 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_203294.1, NP_976039.1 |
| RefSeq Size | 2592 bp |
| RefSeq ORF | 912 bp |
| Locus ID | 81786 |
| UniProt ID | Q9C029 |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (5, also known as GNIP2b) differs in the 5' UTR and the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which is shorter at the N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224809 | TRIM7 (Myc-DDK-tagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 5 |
CNY 3,990.00 |
|
| RC224809L3 | Lenti-ORF clone of TRIM7 (Myc-DDK-tagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 5 |
CNY 5,890.00 |
|
| RC224809L4 | Lenti-ORF clone of TRIM7 (mGFP-tagged)-Human tripartite motif containing 7 (TRIM7), transcript variant 5 |
CNY 5,890.00 |
|
| RG224809 | TRIM7 (tGFP-tagged) - Human tripartite motif containing 7 (TRIM7), transcript variant 5 |
CNY 4,370.00 |
