SEP15 (NM_203341) Human Untagged Clone
CAT#: SC308125
41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Synonyms | SEP15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308125 representing NM_203341.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTAGCGATGGCGGCTGGGCCGAGTGGGTGTCTGGTGCCGGCGTTTGGGCTACGGTTGTTGTTGGCG ACTGTGCTTCAAGCGGTGTCTGCTTTTGGGGCAGAGTTTTCATCGGAGGCATGCAGAGAGTTAGGCTTT TCTAGCAACTTGCTTTGCAGCTCTTGTGATCTTCTCGGACAGTTCAACCTGCTTCAGCTGGATCCTGAT TGCAGAGGATGCTGTCAGGAGGAAGCACAATTTGAAACCAAAAAGCTGTATGCAGGAGCTATTCTTGAA GTTTGTGGATGAAAATTGGGAAGGTTCCCTCAAGTCCAAGTATGTCCGTGGTTCAGACCCTGTATTAAA GCTTTTGGACGACAATGGGAACATTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_203341 |
Insert Size | 375 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_203341.1 |
RefSeq Size | 1801 bp |
RefSeq ORF | 375 bp |
Locus ID | 9403 |
UniProt ID | O60613 |
MW | 13.5 kDa |
Gene Summary | The protein encoded by this gene belongs to the SEP15/selenoprotein M family. The exact function of this protein is not known; however, it has been found to associate with UDP-glucose:glycoprotein glucosyltransferase (UGTR), an endoplasmic reticulum(ER)-resident protein, which is involved in the quality control of protein folding. The association with UGTR retains this protein in the ER, where it may play a role in protein folding. It has also been suggested to have a role in cancer etiology. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205084 | SEP15 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 1,200.00 |
|
RC205084L1 | Lenti-ORF, 41532 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) |
CNY 3,600.00 |
|
RG205084 | 41532 (GFP-tagged) - Human 15 kDa selenoprotein (SEP15), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2,800.00 |
|
SC321079 | 41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3,696.00 |
其它SELENOF产品