ACYP1 (NM_203488) Human Untagged Clone
CAT#: SC308210
ACYP1 (untagged)-Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACYPE |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_203488, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAAGGTGCAAGGG GTGTTTTTCCGTAAGCATACTCAGGAAATGACTGTTGAAAACAGAATTGCTGAAACTCAC AGCAAGAGCTGTGTTCCAGTTAGCTTTGCTACCAGTTATGCAGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_203488 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_203488.1, NP_982355.1 |
RefSeq Size | 700 bp |
RefSeq ORF | 168 bp |
Locus ID | 97 |
Protein Pathways | Pyruvate metabolism |
Gene Summary | This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, that causes a frameshift. The resulting protein (isoform b) has a shorter and distinct C-terminus, compared to isoform a. Although the transcript is experimentally supported, the predicted protein encoded by this transcript needs to be experimentally verified. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218256 | ACYP1 (Myc-DDK-tagged)-Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2 |
CNY 3,990.00 |
|
RC218256L3 | Lenti-ORF clone of ACYP1 (Myc-DDK-tagged)-Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2 |
CNY 5,890.00 |
|
RC218256L4 | Lenti-ORF clone of ACYP1 (mGFP-tagged)-Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2 |
CNY 5,890.00 |
|
RG218256 | ACYP1 (tGFP-tagged) - Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 2 |
CNY 4,370.00 |