Inactive ubiquitin carboxyl terminal hydrolase 50 (USP50) (NM_203494) Human Untagged Clone
CAT#: SC308211
USP50 (untagged)-Human ubiquitin specific peptidase 50 (USP50)
CNY 3,656.00
CNY 5,420.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_203494, the custom clone sequence may differ by one or more nucleotides
ATGACTTCTCAGCCGTCTCTCCCTGCAGATGACTTCGATATCTACCACGTCCTTGCAGAGTGCACAGATT ACTATGATACCCTTCCAGTTAAGGAGGCTGATGGGAACCAGCCCCATTTTCAGGGTGTCACTGGCTTGTG GAACTTGGGCAACACATGCTGCGTGAATGCCATCTCACAGTGTCTCTGCAGCATCTTGCCGCTGGTGGAA TACTTTCTCACCGGGAAGTATATCACCGCTCTGCAAAACGATTGCAGTGAAGTTGCCACTGCTTTTGCCT ATCTGATGACAGACATGTGGCTGGGAGACTCAGACTGTGTCTCACCAGAAATATTCTGGTCAGCTCTTGG CAACCTCTACCCAGCATTTACGAAAAAGATGCAACAAGATGCTCAGGAATTCTTGATTTGTGTCCTAAAT GAACTTCATGAAGCTCTAAAAAAGTACCACTACTCCCGGAGAAGATCATATGAGAAAGGATCTACTCAGA GATGCTGCAGGAAGTGGATTACCACTGAGACATCCATCATCACCCAGCTGTTTGAAGAGCAGCTCAATTA TAGCATCGTATGTTTAAAGTGTGAGAAATGCACCTACAAGAACGAAGTCTTCACTGTCTTCTCACTCCCC ATTCCATCCAAATATGAATGCTCCCTTCGGGACTGTCTCCAATGTTTTTTTCAACAAGACGCACTGACCT GGAACAACGAAATTCACTGCTCCTTTTGTGAAACCAAGCAAGAAACTGCTGTGAGGGCCAGTATTTCCAA AGCACCAAAAATAATTATTTTCCACCTAAAAAGGTTTGACATTCAGGGTACAACAAAAAGGAAGCTGAGA ACGGATATTCATTACCCACTCACTAACTTGGACCTCACTCCTTATATTTGCTCAATTTTCCGGAAATATC CTAAATACAACCTCTGTGCAGTGGTGAACCATTTTGGTGATTTGGATGGTGGCCACTACACTGCTTTCTG CAAGAATTCAGTCACCCAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_203494 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_203494.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_203494.1, NP_987090.1 |
RefSeq Size | 1020 bp |
RefSeq ORF | 1020 bp |
Locus ID | 373509 |
UniProt ID | Q70EL3 |
Protein Families | Druggable Genome |
Gene Summary | Has no peptidase activity.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213264 | USP50 (Myc-DDK-tagged)-Human ubiquitin specific peptidase 50 (USP50) |
CNY 3,656.00 |
|
RC213264L1 | Lenti ORF clone of Human ubiquitin specific peptidase 50 (USP50), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC213264L2 | Lenti ORF clone of Human ubiquitin specific peptidase 50 (USP50), mGFP tagged |
CNY 5,890.00 |
|
RC213264L3 | Lenti ORF clone of Human ubiquitin specific peptidase 50 (USP50), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213264L4 | Lenti ORF clone of Human ubiquitin specific peptidase 50 (USP50), mGFP tagged |
CNY 5,890.00 |
|
RG213264 | USP50 (tGFP-tagged) - Human ubiquitin specific peptidase 50 (USP50) |
CNY 4,370.00 |
其它Inactive ubiquitin carboxyl terminal hydrolase 50产品