Myelin oligodendrocyte glycoprotein (MOG) (NM_206810) Human Untagged Clone

CAT#: SC308259

MOG (untagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant beta5



  "NM_206810" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MOG rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTN6; BTNL11; MOGIG2; NRCLP7
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_206810, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTCCTCCTCCTCCTC
CTCCTCCAAGTGTCTTCCAGCTATGCAGGGCAGTTCAGAGTGATAGGACCAAGACACCCT
ATCCGGGCTCTGGTCGGGGATGAAGTGGAATTGCCATGTCGCATATCTCCTGGGAAGAAC
GCTACAGGCATGGAGGTGGGGTGGTACCGCCCCCCCTTCTCTAGGGTGGTTCATCTCTAC
AGAAATGGCAAGGACCAAGATGGAGACCAGGCACCTGAATATCGGGGCCGGACAGAGCTG
CTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCAGGATCCGGAATGTAAGGTTCTCA
GATGAAGGAGGTTTCACCTGCTTCTTCCGAGATCATTCTTACCAAGAGGAGGCAGCAATG
GAATTGAAAGTAGAAGATCCTTTCTACTGGGTGAGCCCTGGAGTGCTGGTTCTCCTCGCG
GTGCTGCCTGTGCTCCTCCTGCAGATCACTGTTGGCCTCATCTTCCTCTGCCTGCAGTAC
AGACTGAGAGGAAAACTTCGAGCAGAGATAGAGAATCTCCACCGGACTTTTGGGCAATTC
CTTGAAGAGCTACTCTTCCACCTGGAAGCCCTCTCTGGCTAA
Restriction Sites Please inquire     
ACCN NM_206810
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_206810.2, NP_996533.2
RefSeq Size 1752 bp
RefSeq ORF 642 bp
Locus ID 4340
UniProt ID Q16653
Protein Families Transmembrane
Gene Summary The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (beta5) lacks an in-frame segment of the coding region, compared to variant beta1. It encodes a shorter isoform (beta5), also known as isoform 3, that is missing an internal segment, compared to isoform beta1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...