QK1 (QKI) (NM_206855) Human Untagged Clone

CAT#: SC308287

QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 4



  "NM_206855" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
QKI Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Hqk; hqkI; QK; QK1; QK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308287 representing NM_206855.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAGCTGATGAAC
GACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGAC
GAAGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACATTAAATGGCAGTACAGAGAAAAGGAGT
GCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAA
TACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCA
GAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAAT
AGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAG
AACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAA
GGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAATGGCACCTACAGAGATGCC
AACATTAAATCACCAGCCCTTGCCTTTTCTCTTGCAGCAACAGCCCAGGCTGCTCCAAGGATCATTACT
GGGCCTGCGCCGGTTCTCCCACCAGCTGCCCTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCT
TTGATCAGACAAATACAGACCGCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCT
CCAGGGCCCGAAGCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCA
ATCCTTGAGTATCCTATTGAACCTAGTGGTGTATTAGGTAAGTTCTTCTCCCCATGGGGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_206855
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_206855.2
RefSeq Size 16378 bp
RefSeq ORF 960 bp
Locus ID 9444
UniProt ID Q96PU8
MW 35.2 kDa
Gene Summary The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) differs in the 3' UTR and coding region compared to variant 1, which results in a frameshift. The resulting isoform (4; also known as HQK-7B and QKI-7b) is shorter and has a distinct C-terminus compared to isoform 1. Isoforms 2 and 4 are the same length but have different C-termini. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...