United States
Germany
Japan
United Kingdom
China
FAM3B (NM_206964) Human Untagged Clone
CAT＃: SC308350
FAM3B (untagged)-Human family with sequence similarity 3, member B (FAM3B), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2-21; C21orf11; C21orf76; ORF9; PANDER; PRED44 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_206964 edited
GGGCTCCGCTGGCTGCGGTCGCCTGGGAGCTGCCGCCAGGGCCAGGAGGGGAGCGGCACC TGGAAGATGCGCCCATTGGCTGGTGGCCTGCTCAAGGTGGTGTTCGTGGTCTTCGCCTCC TTGTGTGCCTGGTATTCGGGGTACCTGCTCGCAGAGCTCATTCCAGATGCACCCCTGTCC AGTGCTGCCTATAGCATCCGCAGCATCGGGGAGAGGCCTGTCCTCAAAGCTCCAGTCCCC AAAAGGCAAAAATGTGACCACTGGACTCCCTGCCCATCTGACACCTATGCCTACAGGTTA CTCAGCGGAGGTGGCAGAAGCAAGTACGCCAAAATCTGCTTTGAGGATAACCTACTTATG GGAGAACAGCTGGGAAATGTTGCCAGAGGAATAAACATTGCCATTGTCAACTATGTAACT GGGAATGTGACAGCAACACGATGTTTTGATATGTATGAAGGCGATAACTCTGGACCGATG ACAAAGTTTATTCAGAGTGCTGCTCCAAAATCCCTGCTCTTCATGGTGACCTATGACGAC GGAAGCACAAGACTGAATAACGATGCCAAGAATGCCATAGAAGCACTTGGAAGTAAAGAA ATCAGGAACATGAAATTCAGGTCTAGCTGGGTATTTATTGCAGCAAAAGGCTTGGAACTC CCTTCCGAAATTCAGAGAGAAAAGATCAACCACTCTGATGCTAAGAACAACAGATATTCT GGCTGGCCTGCAGAGATCCAGATAGAAGGCTGCATACCCAAAGAACGAAGCTGACACTGC AGGGTCCTGAGTAAATGTGTTCTGTATAAACAAATGCAGCTGGAATCGCTCAAGAATCTT ATTTTTCTAAATCCAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_206964 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_206964.1, NP_996847.1 |
| RefSeq Size | 1240 bp |
| RefSeq ORF | 564 bp |
| Locus ID | 54097 |
| UniProt ID | P58499 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Gene Summary | Induces apoptosis of alpha and beta cells in a dose- and time-dependent manner.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218805 | FAM3B (Myc-DDK-tagged)-Human family with sequence similarity 3, member B (FAM3B), transcript variant 2 |
CNY 2,400.00 |
|
| RC218805L1 | Lenti ORF clone of Human family with sequence similarity 3, member B (FAM3B), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC218805L2 | Lenti ORF clone of Human family with sequence similarity 3, member B (FAM3B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC218805L3 | Lenti ORF clone of Human family with sequence similarity 3, member B (FAM3B), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218805L4 | Lenti ORF clone of Human family with sequence similarity 3, member B (FAM3B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG218805 | FAM3B (tGFP-tagged) - Human family with sequence similarity 3, member B (FAM3B), transcript variant 2 |
CNY 4,370.00 |
