CCL4L1 (NM_207007) Human Untagged Clone
CAT#: SC308362
CCL4L2 (untagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207007, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTA GCACTCTCAGCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCG AGGAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAG CCAGCTGTGGTATTCCAAACCAAAAGAGGCAAGCAAGTCTGCGCTGACCCCAGTGAGTCC TGGGTCCAGGAGTACGTGTATGACCTGGAACTGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_207007 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207007.2, NP_996890.1 |
RefSeq Size | 685 bp |
RefSeq ORF | 279 bp |
Locus ID | 388372 |
UniProt ID | P13236 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway |
Gene Summary | This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (CCL4L) represents the longer transcript and encodes the supported protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210008 | CCL4L2 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
CNY 1,200.00 |
|
RC210008L3 | Lenti-ORF clone of CCL4L2 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
CNY 5,890.00 |
|
RC210008L4 | Lenti-ORF clone of CCL4L2 (mGFP-tagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
CNY 5,890.00 |
|
RG210008 | CCL4L2 (tGFP-tagged) - Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
CNY 4,370.00 |
|
SC321047 | CCL4L2 (untagged)-Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2) |
CNY 1,200.00 |