GCIP interacting protein p29 (SYF2) (NM_207170) Human Untagged Clone

CAT#: SC308402

SYF2 (untagged)-Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2



  "NM_207170" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SYF2 mouse monoclonal antibody, clone OTI6A5 (formerly 6A5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CBPIN; fSAP29; NTC31; P29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308402 representing NM_207170.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGCGCGGAGGAGGGGTCCCTCGCTGCGGCGGCG
GAGCTGGCCGCTCAGAAGCGCGAACAGAGACTGCGCAAATTCCGGGAGCTGCACCTGATGCGGGAATGT
GCGGCAAGAGGAGAAGACTATGAGAAAGTGAAGTTGCTGGAGATCAGTGCAGAAGATGCAGAAAGATGG
GAGAGGAAAAAGAAGAGGAAAAACCCTGATCTGGGATTTTCAGATTATGCTGCTGCCCAGTTACGCCAG
TATCATCGGTTGACCAAGCAGATCAAACCTGACATGGAAACATATGAGAGACTGAGAGAAAAACATGGA
GAAGAGTTTTTCCCAACATCCAATAGTCTTCTTCATGGAACACATGTGCCTTCCACAGAGGAAATTGAC
AGGATGGTCATAGATCTGGAAAAACAGATTGAAAAACGAGACAAATATAGCCGGAGACGTCCTTATAAT
GATGATGCAGATATCGACTACATTAATGAAAGGAATGCCAAATTCAACAAGAAAGCTGAAAGATTCTAT
GGGAAATACACAGCTGAAATTAAACAGAATTTGGAAAGAGGAACAGCTGTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_207170
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207170.3
RefSeq Size 1651 bp
RefSeq ORF 606 bp
Locus ID 25949
UniProt ID O95926
Protein Pathways Spliceosome
MW 23.6 kDa
Gene Summary This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate exon, compared to variant 1, but maintains the reading frame. The resulting protein (isoform 2) is shorter than isoform 1 and lacks both bipartite nuclear localization signals found in isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它GCIP interacting protein p29产品

Customer Reviews 
Loading...