Caspase 1 (CASP1) (NM_033292) Human Untagged Clone
CAT#: SC308821
CASP1 (untagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha
CNY 5,488.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ICE; IL1BC; P45 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_033292 edited
GAGAAAAGCCATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCAT GGGTGAAGGTACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAA GGAAGAGATGGAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTT GATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTG TGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGATCAAACATCTGGAAA TTACCTTAATATGCAAGACTCTCAAGGAGTACTTTCTTCCTTTCCAGCTCCTCAGGCAGT GCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTCAAGCTTTGCTC CCTAGAAGAAGCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTATCCAATAATGGA CAAGTCAAGCCGCACACGTCTTGCTCTCATTATCTGCAATGAAGAATTTGACAGTATTCC TAGAAGAACTGGAGCTGAGGTTGACATCACAGGCATGACAATGCTGCTACAAAATCTGGG GTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCGGACATGACTACAGAGCTGGAGGC ATTTGCACACCGCCCAGAGCACAAGACCTCTGACAGCACGTTCCTGGTGTTCATGTCTCA TGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACA ACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACC GAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGA TTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGC TATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACCAGATAA TGTTTCTTGGAGACATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATAT GCAAGAATATGCCTGTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATT TGAGCAGCCAGATGGTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATG TTTCTACCTCTTCCCAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGAA GTGAAGAGATCCTTCTGTAAAGGTTTTTGGAATTATGTCTGCTGAATAATAAACTTTTTT GAAATAATAAATCTGGTAGAAAAATGAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033292 |
Insert Size | 1400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033292.2, NP_150634.1 |
RefSeq Size | 1364 bp |
RefSeq ORF | 1215 bp |
Locus ID | 834 |
UniProt ID | P29466 |
Domains | Peptidase_C14, CARD, CASc |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway |
Gene Summary | This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (alpha) encodes the longest isoform (alpha). Variant alpha and variant 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Functional genetic screen of human diversity reveals that a methionine salvage enzyme regulates inflammatory cell death
,Dennis C. Ko, Eric R. Gamazon, Kajal P. Shukla, Richard A. Pfuetzner, Dale Whittington, Tarah D. Holden, Mitchell J. Brittnacher, Christine Fong, Matthew Radey, Cassandra Ogohara, Amy L. Stark, Joshua M. Akey, M. Eileen Dolan, Mark M. Wurfel, and Samuel I. Miller,
PNAS, Aug 2012; 109: E2343 - E2352.
[CASP1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218364 | CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha |
CNY 5,488.00 |
|
RC218364L1 | Lenti ORF clone of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC218364L2 | Lenti ORF clone of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, mGFP tagged |
CNY 5,890.00 |
|
RC218364L3 | Lenti ORF clone of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC218364L4 | Lenti ORF clone of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, mGFP tagged |
CNY 7,888.00 |
|
RG218364 | CASP1 (tGFP-tagged) - Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha |
CNY 7,088.00 |
其它Caspase 1产品