PSCA (NM_005672) Human Untagged Clone
CAT#: SC308973
PSCA (untagged)-Human prostate stem cell antigen (PSCA), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 4,070.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRO232 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005672 edited
GTGACCATGAAGGCTGTGCTGCTTGCCCTGTTGATGGCAGGCTTGGCCCTGCAGCCAGGC ACTGCCCTGCTGTGCTACTCCTGCAAAGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTG GAGAACTGCACCCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCCGCGCAGTTGGCCTC CTGACCGTCATCAGCAAAGGCTGCAGCTTGAACTGCGTGGATGACTCACAGGACTACTAC GTGGGCAAGAAGAACATCACGTGCTGTGACACCGACTTGTGCAACGCCAGCGGGGCCCAT GCCCTGCAGCCGGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGG GGACCCGGCCAGCTATAGGCTCTGGGGGGCCCCGCTGCAGCCCACACTGGGTGTGGTGCC CCAGGCCTCTGTGCCACTCCTCACAGACCTGGCCCAGTGGGAGCCTGTCCTGGTTCCTGA GGCACATCCTAACGCAAGTCTGACCATGTATGTCTGCACCCCTGTCCCCCACCCTGACCC TCCCATGGCCCTCTCCAGGACTCCCACCCGGCAGATCAGCTCTAGTGACACAGATCCGCC TGCAGATGGCCCCTCCAACCCTCTCTGCTGCTGTTTCCATGGCCCAGCATTCTCCACCCT TAACCCTGTGCTCAGGCACCTCTTCCCCCAGGAAGCCTTCCCTGCCCACCCCATCTATGA CTTGAGCCAGGTCTGGTCCGTGGTGTCCCCCGCACCCAGCAGGGGACAGGCACTCAGGAG GGCCCAGTAAAGGCTGAGATGAAGTGGACTGAGTAGAACTGGAGGACAAGAGTCGACGTG AGTTCCTGGGAGTCTCCAGAGATGGGGCCTGGAGGCCTGGAGGAAGGGGCCAGGCCTCAC ATTCGTGGGGCTCCCTGAATGGCAGCCTGAGCACAGCGTAGGCCCTTAATAAACACCTGT TGGATAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005672 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005672.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005672.3, NP_005663.1 |
RefSeq Size | 1064 bp |
RefSeq ORF | 372 bp |
Locus ID | 8000 |
UniProt ID | O43653 |
Gene Summary | This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (1) represents the shorter transcript but encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209136 | PSCA (Myc-DDK-tagged)-Human prostate stem cell antigen (PSCA), transcript variant 1 |
CNY 1,200.00 |
|
RC209136L1 | Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC209136L2 | Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC209136L3 | Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209136L4 | Lenti ORF clone of Human prostate stem cell antigen (PSCA), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
RG209136 | PSCA (tGFP-tagged) - Human prostate stem cell antigen (PSCA), transcript variant 1 |
CNY 2,800.00 |