Eph receptor A6 (EPHA6) (NM_173655) Human Untagged Clone

CAT#: SC309198

EPHA6 (untagged)-Human EPH receptor A6 (EPHA6), transcript variant 2



  "NM_173655" in other vectors (4)

CNY 3,656.00

CNY 5,420.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
EPHA6 mouse monoclonal antibody,clone OTI5B9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EHK-2; EHK2; EK12; EPA6; HEK12; PRO57066
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309198 representing NM_173655.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAGACTCTCCATTTCAAGTGACAAAACTGTACTGGCTTAATGAAAAGTGGGACTTTATTGCCTCA
GCTTCTGACATGGCAGCAGAACAAGGACAGATTCTCGTGATAGCCACCGCCGCTGTTGGCGGATTCACT
CTCCTCGTCATCCTCACTTTATTCTTCTTGATCACTGGGAGATGTCAGTGGTACATAAAAGCCAAGATG
AAGTCAGAAGAGAAGAGAAGAAACCACTTACAGAATGGGCATTTGCGCTTCCCGGGAATTAAAACTTAC
ATTGATCCAGATACATATGAAGACCCATCCCTAGCAGTCCATGAATTTGCAAAGGAGATTGATCCCTCA
AGAATTCGTATTGAGAGAGTCATTGGGGCAGGTGAATTTGGAGAAGTCTGTAGTGGGCGTTTGAAGACA
CCAGGGAAAAGAGAGATCCCAGTTGCCATTAAAACTTTGAAAGGTGGCCACATGGATCGGCAAAGAAGA
GATTTTCTAAGAGAAGCTAGTATCATGGGCCAGTTTGACCATCCAAACATCATTCGCCTAGAAGGGGTT
GTCACCAAAAGATCCTTCCCGGCCATTGGGGTGGAGGCGTTTTGCCCCAGCTTCCTGAGGGCAGGGTTT
TTAAATAGCATCCAGGCCCCGCATCCAGTGCCAGGGGGAGGATCTTTGCCCCCCAGGATTCCTGCTGGC
AGACCAGTAATGATTGTGGTGGAATATATGGAGAATGGATCCCTAGACTCCTTTTTGCGGAAGCATGAT
GGCCACTTCACAGTCATCCAGTTGGTCGGAATGCTCCGAGGCATTGCATCAGGCATGAAGTATCTTTCT
GATATGGGTTATGTTCATCGAGACCTAGCGGCTCGGAATATACTGGTCAATAGCAACTTAGTATGCAAA
GTTTCTGATTTTGGTCTCTCCAGAGTGCTGGAAGATGATCCAGAAGCTGCTTATACAACAACTGACCTC
TTCCAAACTCTAACACTTAACCTCTGCTATTCTGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_173655
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173655.1
RefSeq Size 1670 bp
RefSeq ORF 1005 bp
Locus ID 285220
UniProt ID Q9UF33
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Axon guidance
MW 37.3 kDa
Gene Summary Receptor tyrosine kinase which binds promiscuously GPI-anchored ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains multiple differences at the 5' and 3' ends, compared to variant 1. It represents use of an alternate promoter and initiates translation at an alternate start codon. The encoded isoform (b) is shorter and has distinct N- and C- termini, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...