United States
Germany
Japan
United Kingdom
China
PAX3 (NM_181460) Human Untagged Clone
CAT＃: SC309538
PAX3 (untagged)-Human paired box 3 (PAX3), transcript variant PAX3H
CNY 6,560.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CDHS; HUP2; WS1; WS3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_181460, the custom clone sequence may differ by one or more nucleotides
ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTAC CCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAG CTCGGCGGTGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGATCGTG GAGATGGCCCACCACGGCATCCGGCCCTGCGTCATCTCGCGCCAGCTGCGCGTGTCCCAC GGCTGCGTCTCCAAGATCCTGTGCAGGTACCAGGAGACTGGCTCCATACGTCCTGGTGCC ATCGGCGGCAGCAAGCCCAAGCAGGTGACAACGCCTGACGTGGAGAAGAAAATTGAGGAA TACAAAAGAGAGAACCCGGGCATGTTCAGCTGGGAAATCCGAGACAAATTACTCAAGGAC GCGGTCTGTGATCGAAACACCGTGCCGTCAGTGAGTTCCATCAGCCGCATCCTGAGAAGT AAATTCGGGAAAGGTGAAGAGGAGGAGGCCGACTTGGAGAGGAAGGAGGCAGAGGAAAGC GAGAAGAAGGCCAAACACAGCATCGACGGCATCCTGAGCGAGCGAGCCTCAGCACCCCAA TCAGATGAAGGCTCTGATATTGACTCTGAACCAGATTTACCACTAAAGAGGAAACAGCGC AGAAGCCGAACCACCTTCACAGCAGAACAGCTGGAGGAACTGGAGCGTGCTTTTGAGAGA ACTCATTACCCTGACATTTATACTAGGGAGGAACTGGCCCAGAGGGCGAAGCTCACCGAG GCCCGAGTACAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAGCAAGCTGGGGCC AATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCCACTGCCATGCCG ACCTTGCCAACGTACCAGCTGTCGGAGACCTCTTACCAGCCCACATCTATTCCACAAGCT GTGTCAGATCCCAGCAGCACCGTTCACAGACCTCAACCGCTTCCTCCAAGCACTGTACAC CAAAGCACGATTCCTTCCAACCCAGACAGCAGCTCTGCCTACTGCCTCCCCAGCACCAGG CATGGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATG AACCCCACCATTGGCAATGGCCTCTCACCTCAGGTGCCTTTCATTATCTCAAGCCAGATA TCGCTTGGTTTCAAATCCTTTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_181460 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_181460.1, NP_852125.1 |
| RefSeq Size | 2923 bp |
| RefSeq ORF | 1224 bp |
| Locus ID | 5077 |
| UniProt ID | P23760 |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors |
| Gene Summary | This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (PAX3H) differs in the 3' UTR, and contains an alternate splice pattern in the 3' coding region, compared to variant PAX3. The resulting protein (isoform PAX3h) is shorter and has a distinct C-terminus, compared to variant PAX3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215348 | PAX3 (Myc-DDK-tagged)-Human paired box 3 (PAX3), transcript variant PAX3H |
CNY 3,656.00 |
|
| RC215348L3 | Lenti-ORF clone of PAX3 (Myc-DDK-tagged)-Human paired box 3 (PAX3), transcript variant PAX3H |
CNY 5,890.00 |
|
| RC215348L4 | Lenti-ORF clone of PAX3 (mGFP-tagged)-Human paired box 3 (PAX3), transcript variant PAX3H |
CNY 5,890.00 |
|
| RG215348 | PAX3 (tGFP-tagged) - Human paired box 3 (PAX3), transcript variant PAX3H |
CNY 4,370.00 |
