PTGER3 (NM_198719) Human Untagged Clone
CAT#: SC309549
PTGER3 (untagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9
CNY 6,370.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; lnc003875; PGE2-R |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_198719, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAGACCCGGGGCTACGGAGGGGATGCCCCCTTCTGCACCCGCCTCAACCACTCC TACACAGGCATGTGGGCGCCCGAGCGTTCCGCCGAGGCGCGGGGCAACCTCACGCGCCCT CCAGGGTCTGGCGAGGATTGCGGATCGGTGTCCGTGGCCTTCCCGATCACCATGCTGCTC ACTGGTTTCGTGGGCAACGCACTGGCCATGCTGCTCGTGTCGCGCAGCTACCGGCGCCGG GAGAGCAAGCGCAAGAAGTCCTTCCTGCTGTGCATCGGCTGGCTGGCGCTCACCGACCTG GTCGGGCAGCTTCTCACCACCCCGGTCGTCATCGTCGTGTACCTGTCCAAGCAGCGTTGG GAGCACATCGACCCGTCGGGGCGGCTCTGCACCTTTTTCGGGCTGACCATGACTGTTTTC GGGCTCTCCTCGTTGTTCATCGCCAGCGCCATGGCCGTCGAGCGGGCGCTGGCCATCAGG GCGCCGCACTGGTATGCGAGCCACATGAAGACGCGTGCCACCCGCGCTGTGCTGCTCGGC GTGTGGCTGGCCGTGCTCGCCTTCGCCCTGCTGCCGGTGCTGGGCGTGGGCCAGTACACC GTCCAGTGGCCCGGGACGTGGTGCTTCATCAGCACCGGGCGAGGGGGCAACGGGACTAGC TCTTCGCATAACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTG GCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGC CGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACG GCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATA ATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAG AAGCAGAAAGAATGCAACTTCTTCTTAATAGCTGTTCGCCTGGCTTCACTGAACCAGATC TTGGATCCTTGGGTTTACCTGCTGTTAAGAAAGATCCTTCTTCGAAAGTTTTGCCAGATC AGGTACCACACAAACAACTATGCATCCAGCTCCACCTCCTTACCCTGCCAGTGTTCCTCA ACCTTGATGTGGAGCGACCATTTGGAAAGATAA |
Restriction Sites | Please inquire |
ACCN | NM_198719 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198719.1, NP_942012.1 |
RefSeq Size | 2353 bp |
RefSeq ORF | 1173 bp |
Locus ID | 5733 |
UniProt ID | P43115 |
Protein Families | Druggable Genome, GPCR, Transcription Factors, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (9) has multiple differences compared to variant 1. The resulting protein (isoform 4) has a distinct and shorter C-terminus, as compared to isoform 1. Transcript variants 4, 9 and 11 encode the same protein. Other names for variant 9 are EP3A, EP3-I, EP3a2, and EP3 subtype 1a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222983 | PTGER3 (Myc-DDK-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9 |
CNY 3,990.00 |
|
RC222983L3 | Lenti-ORF clone of PTGER3 (Myc-DDK-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9 |
CNY 5,890.00 |
|
RC222983L4 | Lenti-ORF clone of PTGER3 (mGFP-tagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9 |
CNY 5,890.00 |
|
RG222983 | PTGER3 (tGFP-tagged) - Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9 |
CNY 4,370.00 |